crispr activation plasmid Search Results


93
Santa Cruz Biotechnology mta1 crispr activation plasmid
Leptin upregulates <t>MTA1</t> expression in human breast cancer cells. MTA1 mRNA expression was analyzed using qPCR in MDA-MB-231 ( A ) and Hs 578T cells ( B ) after leptin treatment for 24 h. Results are expressed as mean ± SD; * p < 0.05 and ** p < 0.01 vs. untreated control. MTA1 protein expression was assessed using Western blot in MDA-MB-231 ( C ) and Hs 578T cells ( D ) after 24 h of leptin treatment.
Mta1 Crispr Activation Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+activation+plasmid/pmc12192624-97-34-38?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 1 article reviews
mta1 crispr activation plasmid - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
Santa Cruz Biotechnology crispr activation system for tet1
AKG-TET deficiency leads to replicative senescence aHDFs (3 × 10 5 cells/mL) were seeded in each culture plate and were treated, in triplicate, without (UT) or treated (T) with C35 (5 μM), peptides (20 μM), <t>TET1</t> siRNA ( TET1 i ; 300 nM). Cells treated with Bleomycin (Bleo; 5 μg/mL), or H 2 O 2 (100 μM) were used as positive control. Cells were incubated with 30 μM BrdU for 18 h prior to removal of both the cells and culture media following 7 days of treatment. (A) Heatmap of TET gene expression. (B) TET activity and global DNA levels of 5 mC, 5hmC, and 5 fC. (C) Expression patterns of energy/stress and nutrient-sensing pathways in aging PBMCs mirror those observed in young, actively replicating aHDFs (week 3) undergoing senescence, as well as those treated with TET1 i , C35, and RLS. (D) Expression level of hTERT , NAMPT , and PCNA . (E) Expression level of COL1A1 and ELN. (F) Cellular UPS activity, ATP, NAD + /NADH ratio, and LC3B levels. (G) Cellular levels of LC3B without (−) and after pre-treatment with (+) Bafilomycin A1 (1 μM) for 24 h. (H) Cellular ROS. (I) Extent of oxidative DNA damage assessed by the cellular level of 8OHdG. Positive control was comprised of cells treated with H 2 O 2 and Bleomycin (Bleo). Negative control was comprised of cells treated with CLV. (J) γH2AX immunolocalized to nuclei. For positive control, cells were treated with Bleomycin (Bleo). Intranuclear γH2AX (green) appears as focal spots (red arrows) or as a diffuse pan-nuclear pattern (yellow arrows) in nuclei marked by DAPI (blue) staining. Nuclei are further highlighted by double hashed lines. The boxes in the left pane (scale bars 10 μM) are magnified in the right insets (scale bars 2.5 μm). (K) NFKB1 gene expression. (L) Level of intra-nuclear phosphorylated p65 (p65P). (M) Cellular levels of ROS, IL6, and IL8 were secreted into culture media. (N) Expression levels of senescence markers ( CDKN2A , CDKN1A , CDKN1B , LTA4H , TIMP1 , and MMP1 ). (O) Expression level of LDH toxicity, SAβ-Gal activity, and extracellular level of lactic acid (LA). (P) LDHA1 gene expression. (Q) Rate of proliferation assessed by the quantitation of BrdU incorporated into the nuclei of cells in S-phase. Bar and line graphs show the means ± SD. Boxplots show the first and third quartiles and median values. Points are shown as empty and mean points as filled circles. The distribution of data points is shown by Beeswarm in Violin plots. Statistical significance was assessed using Student’s t test for two-group comparisons. p -values are presented as follows: ns (not significant), p ≤ 5 × 10 −1 , ∗p ≤ 5 × 10 −2 , ∗∗p ≤ 5 × 10 −3 , ∗∗∗p ≤ 5 × 10 −4 .
Crispr Activation System For Tet1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+activation+plasmid/pmc12767804-111-0-10?v=Santa+Cruz+Biotechnology
Average 90 stars, based on 1 article reviews
crispr activation system for tet1 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

93
Addgene inc feng zhang
AKG-TET deficiency leads to replicative senescence aHDFs (3 × 10 5 cells/mL) were seeded in each culture plate and were treated, in triplicate, without (UT) or treated (T) with C35 (5 μM), peptides (20 μM), <t>TET1</t> siRNA ( TET1 i ; 300 nM). Cells treated with Bleomycin (Bleo; 5 μg/mL), or H 2 O 2 (100 μM) were used as positive control. Cells were incubated with 30 μM BrdU for 18 h prior to removal of both the cells and culture media following 7 days of treatment. (A) Heatmap of TET gene expression. (B) TET activity and global DNA levels of 5 mC, 5hmC, and 5 fC. (C) Expression patterns of energy/stress and nutrient-sensing pathways in aging PBMCs mirror those observed in young, actively replicating aHDFs (week 3) undergoing senescence, as well as those treated with TET1 i , C35, and RLS. (D) Expression level of hTERT , NAMPT , and PCNA . (E) Expression level of COL1A1 and ELN. (F) Cellular UPS activity, ATP, NAD + /NADH ratio, and LC3B levels. (G) Cellular levels of LC3B without (−) and after pre-treatment with (+) Bafilomycin A1 (1 μM) for 24 h. (H) Cellular ROS. (I) Extent of oxidative DNA damage assessed by the cellular level of 8OHdG. Positive control was comprised of cells treated with H 2 O 2 and Bleomycin (Bleo). Negative control was comprised of cells treated with CLV. (J) γH2AX immunolocalized to nuclei. For positive control, cells were treated with Bleomycin (Bleo). Intranuclear γH2AX (green) appears as focal spots (red arrows) or as a diffuse pan-nuclear pattern (yellow arrows) in nuclei marked by DAPI (blue) staining. Nuclei are further highlighted by double hashed lines. The boxes in the left pane (scale bars 10 μM) are magnified in the right insets (scale bars 2.5 μm). (K) NFKB1 gene expression. (L) Level of intra-nuclear phosphorylated p65 (p65P). (M) Cellular levels of ROS, IL6, and IL8 were secreted into culture media. (N) Expression levels of senescence markers ( CDKN2A , CDKN1A , CDKN1B , LTA4H , TIMP1 , and MMP1 ). (O) Expression level of LDH toxicity, SAβ-Gal activity, and extracellular level of lactic acid (LA). (P) LDHA1 gene expression. (Q) Rate of proliferation assessed by the quantitation of BrdU incorporated into the nuclei of cells in S-phase. Bar and line graphs show the means ± SD. Boxplots show the first and third quartiles and median values. Points are shown as empty and mean points as filled circles. The distribution of data points is shown by Beeswarm in Violin plots. Statistical significance was assessed using Student’s t test for two-group comparisons. p -values are presented as follows: ns (not significant), p ≤ 5 × 10 −1 , ∗p ≤ 5 × 10 −2 , ∗∗p ≤ 5 × 10 −3 , ∗∗∗p ≤ 5 × 10 −4 .
Feng Zhang, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+activation+plasmid/pmc09126361-46-11-14?v=Addgene+inc
Average 93 stars, based on 1 article reviews
feng zhang - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
Santa Cruz Biotechnology tsp 1 crispr activation plasmid
AKG-TET deficiency leads to replicative senescence aHDFs (3 × 10 5 cells/mL) were seeded in each culture plate and were treated, in triplicate, without (UT) or treated (T) with C35 (5 μM), peptides (20 μM), <t>TET1</t> siRNA ( TET1 i ; 300 nM). Cells treated with Bleomycin (Bleo; 5 μg/mL), or H 2 O 2 (100 μM) were used as positive control. Cells were incubated with 30 μM BrdU for 18 h prior to removal of both the cells and culture media following 7 days of treatment. (A) Heatmap of TET gene expression. (B) TET activity and global DNA levels of 5 mC, 5hmC, and 5 fC. (C) Expression patterns of energy/stress and nutrient-sensing pathways in aging PBMCs mirror those observed in young, actively replicating aHDFs (week 3) undergoing senescence, as well as those treated with TET1 i , C35, and RLS. (D) Expression level of hTERT , NAMPT , and PCNA . (E) Expression level of COL1A1 and ELN. (F) Cellular UPS activity, ATP, NAD + /NADH ratio, and LC3B levels. (G) Cellular levels of LC3B without (−) and after pre-treatment with (+) Bafilomycin A1 (1 μM) for 24 h. (H) Cellular ROS. (I) Extent of oxidative DNA damage assessed by the cellular level of 8OHdG. Positive control was comprised of cells treated with H 2 O 2 and Bleomycin (Bleo). Negative control was comprised of cells treated with CLV. (J) γH2AX immunolocalized to nuclei. For positive control, cells were treated with Bleomycin (Bleo). Intranuclear γH2AX (green) appears as focal spots (red arrows) or as a diffuse pan-nuclear pattern (yellow arrows) in nuclei marked by DAPI (blue) staining. Nuclei are further highlighted by double hashed lines. The boxes in the left pane (scale bars 10 μM) are magnified in the right insets (scale bars 2.5 μm). (K) NFKB1 gene expression. (L) Level of intra-nuclear phosphorylated p65 (p65P). (M) Cellular levels of ROS, IL6, and IL8 were secreted into culture media. (N) Expression levels of senescence markers ( CDKN2A , CDKN1A , CDKN1B , LTA4H , TIMP1 , and MMP1 ). (O) Expression level of LDH toxicity, SAβ-Gal activity, and extracellular level of lactic acid (LA). (P) LDHA1 gene expression. (Q) Rate of proliferation assessed by the quantitation of BrdU incorporated into the nuclei of cells in S-phase. Bar and line graphs show the means ± SD. Boxplots show the first and third quartiles and median values. Points are shown as empty and mean points as filled circles. The distribution of data points is shown by Beeswarm in Violin plots. Statistical significance was assessed using Student’s t test for two-group comparisons. p -values are presented as follows: ns (not significant), p ≤ 5 × 10 −1 , ∗p ≤ 5 × 10 −2 , ∗∗p ≤ 5 × 10 −3 , ∗∗∗p ≤ 5 × 10 −4 .
Tsp 1 Crispr Activation Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+activation+plasmid/pmc08751882__JAH3___10___e022701___s001-3-18-23?v=Santa+Cruz+Biotechnology
Average 90 stars, based on 1 article reviews
tsp 1 crispr activation plasmid - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

94
Santa Cruz Biotechnology control crispr activation plasmid
AKG-TET deficiency leads to replicative senescence aHDFs (3 × 10 5 cells/mL) were seeded in each culture plate and were treated, in triplicate, without (UT) or treated (T) with C35 (5 μM), peptides (20 μM), <t>TET1</t> siRNA ( TET1 i ; 300 nM). Cells treated with Bleomycin (Bleo; 5 μg/mL), or H 2 O 2 (100 μM) were used as positive control. Cells were incubated with 30 μM BrdU for 18 h prior to removal of both the cells and culture media following 7 days of treatment. (A) Heatmap of TET gene expression. (B) TET activity and global DNA levels of 5 mC, 5hmC, and 5 fC. (C) Expression patterns of energy/stress and nutrient-sensing pathways in aging PBMCs mirror those observed in young, actively replicating aHDFs (week 3) undergoing senescence, as well as those treated with TET1 i , C35, and RLS. (D) Expression level of hTERT , NAMPT , and PCNA . (E) Expression level of COL1A1 and ELN. (F) Cellular UPS activity, ATP, NAD + /NADH ratio, and LC3B levels. (G) Cellular levels of LC3B without (−) and after pre-treatment with (+) Bafilomycin A1 (1 μM) for 24 h. (H) Cellular ROS. (I) Extent of oxidative DNA damage assessed by the cellular level of 8OHdG. Positive control was comprised of cells treated with H 2 O 2 and Bleomycin (Bleo). Negative control was comprised of cells treated with CLV. (J) γH2AX immunolocalized to nuclei. For positive control, cells were treated with Bleomycin (Bleo). Intranuclear γH2AX (green) appears as focal spots (red arrows) or as a diffuse pan-nuclear pattern (yellow arrows) in nuclei marked by DAPI (blue) staining. Nuclei are further highlighted by double hashed lines. The boxes in the left pane (scale bars 10 μM) are magnified in the right insets (scale bars 2.5 μm). (K) NFKB1 gene expression. (L) Level of intra-nuclear phosphorylated p65 (p65P). (M) Cellular levels of ROS, IL6, and IL8 were secreted into culture media. (N) Expression levels of senescence markers ( CDKN2A , CDKN1A , CDKN1B , LTA4H , TIMP1 , and MMP1 ). (O) Expression level of LDH toxicity, SAβ-Gal activity, and extracellular level of lactic acid (LA). (P) LDHA1 gene expression. (Q) Rate of proliferation assessed by the quantitation of BrdU incorporated into the nuclei of cells in S-phase. Bar and line graphs show the means ± SD. Boxplots show the first and third quartiles and median values. Points are shown as empty and mean points as filled circles. The distribution of data points is shown by Beeswarm in Violin plots. Statistical significance was assessed using Student’s t test for two-group comparisons. p -values are presented as follows: ns (not significant), p ≤ 5 × 10 −1 , ∗p ≤ 5 × 10 −2 , ∗∗p ≤ 5 × 10 −3 , ∗∗∗p ≤ 5 × 10 −4 .
Control Crispr Activation Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+activation+plasmid/pmc07937563__mmc1-27-4-21?v=Santa+Cruz+Biotechnology
Average 94 stars, based on 1 article reviews
control crispr activation plasmid - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology bdnf crispr activation plasmid h
( A ) A schematic representation of the transplantation of DPSC into the first molar tooth after drilling. ( B ) The confirmation of <t>BDNF</t> <t>CRISPR</t> activation plasmid enhanced the expression of pro-BDNF. ( C ) Bar graph showing the integrated intensity of CRISPR-engineered BDNF-activated DPSCs against β-actin compared to control. ( D ) H&E staining of sham control and injured tooth in mouse (n = 6 each group) transplanted with CRISPR-engineered BDNF-overexpressing DPSCs. Scale bar: 100 μm. Figure 4—source data 1. Original files for western blot images displayed in . Figure 4—source data 2. Original files for western blot images displayed in with labeling.
Bdnf Crispr Activation Plasmid H, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+activation+plasmid/pmc12240581-40-0-13?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 1 article reviews
bdnf crispr activation plasmid h - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

93
Addgene inc sabatini lander list
( A ) A schematic representation of the transplantation of DPSC into the first molar tooth after drilling. ( B ) The confirmation of <t>BDNF</t> <t>CRISPR</t> activation plasmid enhanced the expression of pro-BDNF. ( C ) Bar graph showing the integrated intensity of CRISPR-engineered BDNF-activated DPSCs against β-actin compared to control. ( D ) H&E staining of sham control and injured tooth in mouse (n = 6 each group) transplanted with CRISPR-engineered BDNF-overexpressing DPSCs. Scale bar: 100 μm. Figure 4—source data 1. Original files for western blot images displayed in . Figure 4—source data 2. Original files for western blot images displayed in with labeling.
Sabatini Lander List, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+activation+plasmid/pmc12765214-353-70-72?v=Addgene+inc
Average 93 stars, based on 1 article reviews
sabatini lander list - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology dusp22 crispr activation plasmid
( A ) <t>DUSP22</t> expression in aged individuals (over 70 years, n = 15) and aged individuals diagnosed with sarcopenia (over 70 years, n = 18), p = 0.0009 (obtained from the Singapore Sarcopenia Study; (GEO accession no. GSE111016 (Migliavacca et al, )). ( B ) DUSP22 expression in C2C12 murine myotubes treated with vehicle or dexamethasone (Dex) to induce atrophy ( n = 3 each) Custer 1 ( p = 0.024), Cluster 2 ( p = 0.13), Cluster 3 ( p = 0.0246). Expression was measured using RNA Seq. TPM=transcript per million. ( C ) qPCR analysis of DUSP22 expression in four models of muscle atrophy: (1) C2C12 myotubes treated with Dex ( n = 5), p = 7.67E−05, (2) the TA muscle of C57BL/6 mice treated with Dex ( n = 4), p = 0.09, (3) the TA muscle of young (5 months-old, n = 9) and geriatric (27 months-old, n = 8) C57BL/6 mice, p = 0.0324, (4) the TA of C57BL/6 mice after hind limb immobilization ( n = 3), p = 0.018. ( D ) qPCR of DUSP22 expression in C2C12 myoblasts transfected with a DUSP22 CRISPR activation plasmid (DUSP22 endo OE) or control plasmid (CON endo OE) ( n = 3), p = 0.0022. ( E ) Fast myosin (MYH2) immunocytochemistry of CON endo OE and DUSP22 endo OE myoblasts after 96 h culture in DM (scale bar = 100 µm). ( F ) Fusion index ( n = 6). ( G ) Differentiation index ( n = 6), p = 9.91E−09. ( H – L ) qPCR analysis of gene expression related to the following: ( H ) Mitochondrial homeostasis (PGC-1α (peroxisome proliferator-activated receptor gamma coactivator 1-alpha, p = 1.44E−05), UCP-3 (mitochondrial uncoupling protein 3, p = 4.61E−05), Acly (ATP citrate lyase, p = 0.5141)) ( n = 4). ( I ) Autophagy (LC-3B (microtubule-associated proteins 1 A/1B light chain 3B, p = 0.0152), CtsL (cathepsin L, p = 4.76E−05)) ( n = 4). ( J ) Ubiquitin-proteasome system (UPS) (UBR2 (ubiquitin protein ligase E3, p = 0.0031), Psmd11 (proteasome 26S subunit, non-ATPase 11, p = 0.1718) ( n = 4). ( K ) Myosin heavy chain levels (slow myosin MYH7, p = 7.23E−06, fast myosin MYH1, p = 0.0171) ( n = 4), and ( L ) FoxO3a-related signaling (FoxO3a ( p = 0.0004), MurF-1 ( p = 0.0019), atrogin-1 ( p = 0.001), p62 ( p = 8.67E−08), TGIF (TGFB induced factor homeobox 1, p = 0.0001), ATF4 (activating transcription factor 4, p = 0.3974), Bnip3 (BCL2/adenovirus E1B 19 kDa protein-interacting protein 3, p = 0.0887); Gadd45a (growth arrest and DNA damage inducible alpha, p = 4.19E−06), SMART (specific of muscle atrophy and regulated by transcription, p = 0.0006), MUSA1 (muscle ubiquitin ligase of SCF complex in atrophy-1, p = 0.2357)) ( n = 4). Box plots represent the distribution of DUSP22 expression levels. The center line indicates the median (50th percentile, Q2), representing the middle value of the dataset. The box bounds correspond to the interquartile range (IQR), extending from the 25th percentile (Q1, lower bound) to the 75th percentile (Q3, upper bound). Whiskers extend to the smallest and largest values within 1.5 × IQR from Q1 and Q3, representing the minimum (lower whisker) and maximum (upper whisker) values within this range. Data points that fall beyond this range are considered outliers and are displayed as individual points outside the whiskers. * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .
Dusp22 Crispr Activation Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+activation+plasmid/pmc12162873-429-10-14?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 1 article reviews
dusp22 crispr activation plasmid - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology igf1r crispr activation plasmid
Effects of Pas2r12 or Pas2r12–cargo protein complex-mediated stimulation on <t>INSR/IGF1R</t> and ERK1/2. HEK293 cells were pretreated with dimethyl sulfoxide (linsitinib [−]) or with linsitinib (linsitinib [+]) and subsequently stimulated with Pas2r12, Pas2r12–EGFP, Pas2r12–IgG, or insulin for 2 min ( A – C ) or 10 min ( D – F ). Panels A and D show representative Western blot images. Panels B and E display the phosphorylation levels of INSR/IGF1R (pINSR/pIGF1R); panels C and F show the phosphorylation levels of ERK1/2 (pERK1/2); all values were normalized to GAPDH. Phosphorylation levels were analyzed and compared with the solvent control (DMEM only, linsitinib [−]) using Student’s t -test. For each treatment condition, linsitinib (+) was compared with the corresponding linsitinib (−) condition. Statistically significant differences compared with the control are indicated on the bar graphs; significant differences between linsitinib (+) and linsitinib (−) treatments are marked by horizontal lines. Statistical comparisons were performed against control cells using Student’s t -test. Error bars indicate the standard error of the mean (SEM). * p < 0.05 and ** p < 0.01. N = 4.
Igf1r Crispr Activation Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+activation+plasmid/pmc12736253-230-11-16?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 1 article reviews
igf1r crispr activation plasmid - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

93
Addgene inc d sabatini
Effects of Pas2r12 or Pas2r12–cargo protein complex-mediated stimulation on <t>INSR/IGF1R</t> and ERK1/2. HEK293 cells were pretreated with dimethyl sulfoxide (linsitinib [−]) or with linsitinib (linsitinib [+]) and subsequently stimulated with Pas2r12, Pas2r12–EGFP, Pas2r12–IgG, or insulin for 2 min ( A – C ) or 10 min ( D – F ). Panels A and D show representative Western blot images. Panels B and E display the phosphorylation levels of INSR/IGF1R (pINSR/pIGF1R); panels C and F show the phosphorylation levels of ERK1/2 (pERK1/2); all values were normalized to GAPDH. Phosphorylation levels were analyzed and compared with the solvent control (DMEM only, linsitinib [−]) using Student’s t -test. For each treatment condition, linsitinib (+) was compared with the corresponding linsitinib (−) condition. Statistically significant differences compared with the control are indicated on the bar graphs; significant differences between linsitinib (+) and linsitinib (−) treatments are marked by horizontal lines. Statistical comparisons were performed against control cells using Student’s t -test. Error bars indicate the standard error of the mean (SEM). * p < 0.05 and ** p < 0.01. N = 4.
D Sabatini, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+activation+plasmid/pmc12442849-234-13-18?v=Addgene+inc
Average 93 stars, based on 1 article reviews
d sabatini - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

92
Santa Cruz Biotechnology parp10 gene knockout
Loss of <t>PARP10</t> impairs proliferation of HeLa cells. ( A ) Western blot showing loss of PARP10 expression in HeLa cells with CRISPR/Cas9-mediated PARP10 knockout. ( B ) PARP10-knockout HeLa cells show reduced proliferation rates. The average of three experiments with error bars representing standard deviations is shown. The asterisk indicates statistical significance (using the two-tailed equal variance TTEST). ( C ) Representative clonogenic assay showing reduced proliferation of PARP10-knockout HeLa cells. ( D ) Representative PI flow cytometry profile showing an altered cell-cycle distribution in PARP10-knockout HeLa cells. ( E ) Quantification of cell-cycle distribution in control and PARP10-knockout HeLa cells. The average of four experiments, with error bars as standard deviations, is shown. Statistical significance was calculated using the two-tailed equal variance TTEST. ( F ) Western blot showing the re-expression of PARP10, with a Myc-tag, in PARP10-knockout HeLa cells. ( G ) Exogenous PARP10 expression rescues the proliferation defect of PARP10-deleted HeLa cells. The average of four experiments with error bars representing standard deviations is shown. The asterisk indicates statistical difference between the PARP10 KO and PARP10 KO + Myc-PARP10 samples.
Parp10 Gene Knockout, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+activation+plasmid/pmc06158756-36-1-13?v=Santa+Cruz+Biotechnology
Average 92 stars, based on 1 article reviews
parp10 gene knockout - by Bioz Stars, 2026-07
92/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology mct8 crispr activation plasmid
DIO3 reduction attenuates glycolysis and elevates OXPHOS in HGSOC cells (A) HGSOC Control and DIO3-KD cells were analyzed by WB for DIO3 (upper panel). Quantification of normalized bands intensity as fold of control is presented in the right panel. All WB’s are representative of at least three independent repeats. Cell density in control and DIO3-KD cells is presented in the lower panel. (10× objective, scale bar: 100 μm) (B) Intracellular levels of the thyroid hormone T4, measured by LC/MS/MS. Values are mean ± STE, ∗, p < 0.05 (C) Proteomaps of the control and DIO3-KD proteomes using the bionic visualization tool. Metabolism-related pathways (orange, right panel). (D) HGSOC Control and DIO3-KD cells were analyzed by WB for a collection of proteins involved in glycolysis and energy production. β-tubulin was used as loading control. Quantification of normalized bands intensity, as fold of control, is presented in the right panel. WB’s are representative of three independent repeats (E) Levels of Fructose-6-phosphate identified by polar metabolites profiling (F) HGSOC control and DIO3-KD cells were seeded (1000cells/well for 96 h) in triplicates and culture media was collected for lactate measurements. A representative result of three independent repeats is presented (G) HGSOC control and DIO3-KD cells were seeded (4x10 4 cells/well) and after 24 h mitochondrial respiration was assessed. OCR was measured under basal conditions followed by sequential injections of oligomycin (1.5 μM), FCCP (1.5 μM) and rotenone (0.5 μM). Bars represent OCR measurements of basal respiration and ATP production. A representative experiment of three independent repeats is shown (H) Levels of ATP/ADP ratio identified by polar metabolites profiling (I) Total proteins were extracted from OVCAR8 control and <t>MCT8</t> over-expression (MCT8-OE) cells and evaluated by WB for MCT8, DIO3, HK1, PFKP, GAPDH, PKM2 and ATP5A. β-tubulin was used as a loading control. Protein loading for MCT8 is presented in . Quantification of normalized bands intensity as fold of control is presented in the right panel WB’s are representative of three independent repeats (J) Total proteins were extracted from WT and p53-KO ID8 cells and evaluated by WB for p53, DIO3, HK1 and HK2. β-actin and β-tubulin were used as loading control. Quantification of normalized bands intensity as fold of control is presented in the right panel (K) Intracellular levels of the thyroid hormone T3 following 24 h treatment with the DIO3 inhibitor ITYR-DBRMD (250 μM), measured by ELISA. A representative results of at least four independent repeats is shown. Values are mean ± STE ∗∗, p < 0.005 (L) 50 × 10 3 ES2 cells were seeded in 24-well plates and treated daily with ITYR-DBRMD (250 nM, 500 nM, 1 μM, 2.5 μM, 5 μM, 7.5 μM and 10 μM), or vehicle control (DMSO). After 96 h, total proteins were extracted and analyzed by WB for the glycolytic proteins HK1, PFKP, GAPDH and PKM2. β-actin was used as a loading control. Quantification of normalized bands intensity as fold of control is presented in the right panel. Experiments are representative of three independent repeats. Values are mean ± STE, ∗ p ≤ 0.05; ∗∗ p ≤ 0.01, ∗∗∗ p ≤ 0.0002, ∗∗∗∗ p ≤ 0.0001. (M) 50 × 10 3 OVCAR8 cells were seeded in 24-well plates and treated daily with 1 μM ITYR-DBRMD, or vehicle control (DMSO). After 72 h RNA was extracted and RNA-Seq analysis was performed.
Mct8 Crispr Activation Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/crispr+activation+plasmid/pmc12357112-83-16-28?v=Santa+Cruz+Biotechnology
Average 93 stars, based on 1 article reviews
mct8 crispr activation plasmid - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

Image Search Results


Leptin upregulates MTA1 expression in human breast cancer cells. MTA1 mRNA expression was analyzed using qPCR in MDA-MB-231 ( A ) and Hs 578T cells ( B ) after leptin treatment for 24 h. Results are expressed as mean ± SD; * p < 0.05 and ** p < 0.01 vs. untreated control. MTA1 protein expression was assessed using Western blot in MDA-MB-231 ( C ) and Hs 578T cells ( D ) after 24 h of leptin treatment.

Journal: International Journal of Molecular Sciences

Article Title: Leptin-Upregulated Metastasis-Associated Protein 1 Promotes Vasculogenic Mimicry in Breast Cancer Cells

doi: 10.3390/ijms26125726

Figure Lengend Snippet: Leptin upregulates MTA1 expression in human breast cancer cells. MTA1 mRNA expression was analyzed using qPCR in MDA-MB-231 ( A ) and Hs 578T cells ( B ) after leptin treatment for 24 h. Results are expressed as mean ± SD; * p < 0.05 and ** p < 0.01 vs. untreated control. MTA1 protein expression was assessed using Western blot in MDA-MB-231 ( C ) and Hs 578T cells ( D ) after 24 h of leptin treatment.

Article Snippet: MDA-MB-231 cells (1.5 × 10 5 ) and Hs 578T cells (2.0 × 10 5 ) were cultured under optimal conditions and transfected with 1 μg of the control or 0.5 μg of the MTA1 CRISPR activation plasmid (Santa Cruz, Danvers, MA, USA) for 48 h. Transfection was performed using the UltraCruz transfection reagent (Santa Cruz), according to the manufacturer’s protocol.

Techniques: Expressing, Control, Western Blot

Leptin upregulates MTA1 expression via the Ob-R/STAT3 pathway in human breast cancer cells. MTA1 protein expression was evaluated using Western blot in MDA-MB-231 ( A , C ) and Hs 578T cells ( B , D ) after 24 h of leptin treatment in the presence or absence of Ob-R BP ( A , B ) or AG490 ( C , D ).

Journal: International Journal of Molecular Sciences

Article Title: Leptin-Upregulated Metastasis-Associated Protein 1 Promotes Vasculogenic Mimicry in Breast Cancer Cells

doi: 10.3390/ijms26125726

Figure Lengend Snippet: Leptin upregulates MTA1 expression via the Ob-R/STAT3 pathway in human breast cancer cells. MTA1 protein expression was evaluated using Western blot in MDA-MB-231 ( A , C ) and Hs 578T cells ( B , D ) after 24 h of leptin treatment in the presence or absence of Ob-R BP ( A , B ) or AG490 ( C , D ).

Article Snippet: MDA-MB-231 cells (1.5 × 10 5 ) and Hs 578T cells (2.0 × 10 5 ) were cultured under optimal conditions and transfected with 1 μg of the control or 0.5 μg of the MTA1 CRISPR activation plasmid (Santa Cruz, Danvers, MA, USA) for 48 h. Transfection was performed using the UltraCruz transfection reagent (Santa Cruz), according to the manufacturer’s protocol.

Techniques: Expressing, Western Blot

MTA1 overexpression promotes VM in human breast cancer cells. MDA-MB-231 ( A , C , E ) and Hs 578T cells ( B , D , F ) were transfected with the MTA1 CRISPR activation plasmid for 48 h. MTA1 protein expression was assessed using Western blot in MDA-MB-231 ( A ) and Hs 578T cells ( B ). VM was performed using a 3D culture assay for 16 h in MDA-MB-231 ( C ) and Hs 578T cells ( D ) (40× magnification; scale bar = 500 μm). Results are expressed as mean ± SD; *** p < 0.001 vs. control plasmid. Expression of VM-related proteins was evaluated using Western blot in MDA-MB-231 ( E ) and Hs 578T cells ( F ).

Journal: International Journal of Molecular Sciences

Article Title: Leptin-Upregulated Metastasis-Associated Protein 1 Promotes Vasculogenic Mimicry in Breast Cancer Cells

doi: 10.3390/ijms26125726

Figure Lengend Snippet: MTA1 overexpression promotes VM in human breast cancer cells. MDA-MB-231 ( A , C , E ) and Hs 578T cells ( B , D , F ) were transfected with the MTA1 CRISPR activation plasmid for 48 h. MTA1 protein expression was assessed using Western blot in MDA-MB-231 ( A ) and Hs 578T cells ( B ). VM was performed using a 3D culture assay for 16 h in MDA-MB-231 ( C ) and Hs 578T cells ( D ) (40× magnification; scale bar = 500 μm). Results are expressed as mean ± SD; *** p < 0.001 vs. control plasmid. Expression of VM-related proteins was evaluated using Western blot in MDA-MB-231 ( E ) and Hs 578T cells ( F ).

Article Snippet: MDA-MB-231 cells (1.5 × 10 5 ) and Hs 578T cells (2.0 × 10 5 ) were cultured under optimal conditions and transfected with 1 μg of the control or 0.5 μg of the MTA1 CRISPR activation plasmid (Santa Cruz, Danvers, MA, USA) for 48 h. Transfection was performed using the UltraCruz transfection reagent (Santa Cruz), according to the manufacturer’s protocol.

Techniques: Over Expression, Transfection, CRISPR, Activation Assay, Plasmid Preparation, Expressing, Western Blot, Control

MTA1 silencing inhibits leptin-induced VM in human breast cancer cells. MDA-MB-231 ( A , C , E ) and Hs 578T cells ( B , D , F ) were treated with leptin 48 h after transfection with MTA1 siRNA. MTA1 protein expression was evaluated using Western blot in MDA-MB-231 ( A ) and Hs 578T cells ( B ). VM was performed using a 3D culture assay for 16 h in MDA-MB-231 ( C ) and Hs 578T cells ( D ) (40× magnification; scale bar = 250 μm). Results are expressed as mean ± SD; *** p < 0.001 vs. untreated control; ### p < 0.001 vs. control siRNA. Expression of VM-related proteins was evaluated using Western blot in MDA-MB-231 ( E ) and Hs 578T cells ( F ).

Journal: International Journal of Molecular Sciences

Article Title: Leptin-Upregulated Metastasis-Associated Protein 1 Promotes Vasculogenic Mimicry in Breast Cancer Cells

doi: 10.3390/ijms26125726

Figure Lengend Snippet: MTA1 silencing inhibits leptin-induced VM in human breast cancer cells. MDA-MB-231 ( A , C , E ) and Hs 578T cells ( B , D , F ) were treated with leptin 48 h after transfection with MTA1 siRNA. MTA1 protein expression was evaluated using Western blot in MDA-MB-231 ( A ) and Hs 578T cells ( B ). VM was performed using a 3D culture assay for 16 h in MDA-MB-231 ( C ) and Hs 578T cells ( D ) (40× magnification; scale bar = 250 μm). Results are expressed as mean ± SD; *** p < 0.001 vs. untreated control; ### p < 0.001 vs. control siRNA. Expression of VM-related proteins was evaluated using Western blot in MDA-MB-231 ( E ) and Hs 578T cells ( F ).

Article Snippet: MDA-MB-231 cells (1.5 × 10 5 ) and Hs 578T cells (2.0 × 10 5 ) were cultured under optimal conditions and transfected with 1 μg of the control or 0.5 μg of the MTA1 CRISPR activation plasmid (Santa Cruz, Danvers, MA, USA) for 48 h. Transfection was performed using the UltraCruz transfection reagent (Santa Cruz), according to the manufacturer’s protocol.

Techniques: Transfection, Expressing, Western Blot, Control

AKG-TET deficiency leads to replicative senescence aHDFs (3 × 10 5 cells/mL) were seeded in each culture plate and were treated, in triplicate, without (UT) or treated (T) with C35 (5 μM), peptides (20 μM), TET1 siRNA ( TET1 i ; 300 nM). Cells treated with Bleomycin (Bleo; 5 μg/mL), or H 2 O 2 (100 μM) were used as positive control. Cells were incubated with 30 μM BrdU for 18 h prior to removal of both the cells and culture media following 7 days of treatment. (A) Heatmap of TET gene expression. (B) TET activity and global DNA levels of 5 mC, 5hmC, and 5 fC. (C) Expression patterns of energy/stress and nutrient-sensing pathways in aging PBMCs mirror those observed in young, actively replicating aHDFs (week 3) undergoing senescence, as well as those treated with TET1 i , C35, and RLS. (D) Expression level of hTERT , NAMPT , and PCNA . (E) Expression level of COL1A1 and ELN. (F) Cellular UPS activity, ATP, NAD + /NADH ratio, and LC3B levels. (G) Cellular levels of LC3B without (−) and after pre-treatment with (+) Bafilomycin A1 (1 μM) for 24 h. (H) Cellular ROS. (I) Extent of oxidative DNA damage assessed by the cellular level of 8OHdG. Positive control was comprised of cells treated with H 2 O 2 and Bleomycin (Bleo). Negative control was comprised of cells treated with CLV. (J) γH2AX immunolocalized to nuclei. For positive control, cells were treated with Bleomycin (Bleo). Intranuclear γH2AX (green) appears as focal spots (red arrows) or as a diffuse pan-nuclear pattern (yellow arrows) in nuclei marked by DAPI (blue) staining. Nuclei are further highlighted by double hashed lines. The boxes in the left pane (scale bars 10 μM) are magnified in the right insets (scale bars 2.5 μm). (K) NFKB1 gene expression. (L) Level of intra-nuclear phosphorylated p65 (p65P). (M) Cellular levels of ROS, IL6, and IL8 were secreted into culture media. (N) Expression levels of senescence markers ( CDKN2A , CDKN1A , CDKN1B , LTA4H , TIMP1 , and MMP1 ). (O) Expression level of LDH toxicity, SAβ-Gal activity, and extracellular level of lactic acid (LA). (P) LDHA1 gene expression. (Q) Rate of proliferation assessed by the quantitation of BrdU incorporated into the nuclei of cells in S-phase. Bar and line graphs show the means ± SD. Boxplots show the first and third quartiles and median values. Points are shown as empty and mean points as filled circles. The distribution of data points is shown by Beeswarm in Violin plots. Statistical significance was assessed using Student’s t test for two-group comparisons. p -values are presented as follows: ns (not significant), p ≤ 5 × 10 −1 , ∗p ≤ 5 × 10 −2 , ∗∗p ≤ 5 × 10 −3 , ∗∗∗p ≤ 5 × 10 −4 .

Journal: iScience

Article Title: AKG-TET axis is central to senescence plasticity

doi: 10.1016/j.isci.2025.114298

Figure Lengend Snippet: AKG-TET deficiency leads to replicative senescence aHDFs (3 × 10 5 cells/mL) were seeded in each culture plate and were treated, in triplicate, without (UT) or treated (T) with C35 (5 μM), peptides (20 μM), TET1 siRNA ( TET1 i ; 300 nM). Cells treated with Bleomycin (Bleo; 5 μg/mL), or H 2 O 2 (100 μM) were used as positive control. Cells were incubated with 30 μM BrdU for 18 h prior to removal of both the cells and culture media following 7 days of treatment. (A) Heatmap of TET gene expression. (B) TET activity and global DNA levels of 5 mC, 5hmC, and 5 fC. (C) Expression patterns of energy/stress and nutrient-sensing pathways in aging PBMCs mirror those observed in young, actively replicating aHDFs (week 3) undergoing senescence, as well as those treated with TET1 i , C35, and RLS. (D) Expression level of hTERT , NAMPT , and PCNA . (E) Expression level of COL1A1 and ELN. (F) Cellular UPS activity, ATP, NAD + /NADH ratio, and LC3B levels. (G) Cellular levels of LC3B without (−) and after pre-treatment with (+) Bafilomycin A1 (1 μM) for 24 h. (H) Cellular ROS. (I) Extent of oxidative DNA damage assessed by the cellular level of 8OHdG. Positive control was comprised of cells treated with H 2 O 2 and Bleomycin (Bleo). Negative control was comprised of cells treated with CLV. (J) γH2AX immunolocalized to nuclei. For positive control, cells were treated with Bleomycin (Bleo). Intranuclear γH2AX (green) appears as focal spots (red arrows) or as a diffuse pan-nuclear pattern (yellow arrows) in nuclei marked by DAPI (blue) staining. Nuclei are further highlighted by double hashed lines. The boxes in the left pane (scale bars 10 μM) are magnified in the right insets (scale bars 2.5 μm). (K) NFKB1 gene expression. (L) Level of intra-nuclear phosphorylated p65 (p65P). (M) Cellular levels of ROS, IL6, and IL8 were secreted into culture media. (N) Expression levels of senescence markers ( CDKN2A , CDKN1A , CDKN1B , LTA4H , TIMP1 , and MMP1 ). (O) Expression level of LDH toxicity, SAβ-Gal activity, and extracellular level of lactic acid (LA). (P) LDHA1 gene expression. (Q) Rate of proliferation assessed by the quantitation of BrdU incorporated into the nuclei of cells in S-phase. Bar and line graphs show the means ± SD. Boxplots show the first and third quartiles and median values. Points are shown as empty and mean points as filled circles. The distribution of data points is shown by Beeswarm in Violin plots. Statistical significance was assessed using Student’s t test for two-group comparisons. p -values are presented as follows: ns (not significant), p ≤ 5 × 10 −1 , ∗p ≤ 5 × 10 −2 , ∗∗p ≤ 5 × 10 −3 , ∗∗∗p ≤ 5 × 10 −4 .

Article Snippet: CRISPR activation system for TET1 ( TET1 CR ) , Santa Cruz Biotechnology (Santa Cruz, CA) , sc-400845-ACT-2.

Techniques: Positive Control, Incubation, Gene Expression, Activity Assay, Expressing, Negative Control, Staining, Quantitation Assay

AKG-TET dependent resilience to damage and protection against damage-induced senescence Proliferating aHDFs (0.3 × 10 6 /mL) and PBMCs (70 years; PBMC 70Yr, 1 × 10 6 /mL) were seeded in culture plates and pre-treated in triplicate without (untreated: UT) or with H 2 O 2 (100 μM) for 24 h. After 24 h, cells were washed and treated without or with CLV (20 μM), or CRISPR TET1 ( TET1 CR ;1 μg/mL). Cells were incubated with 30 μM BrdU for 18 h prior to removal of both the cells and culture media following 7 days of treatment. (A) Expression levels of TETs in PBMCs. (B) AKG bioavailability in PBMCs. (C) Expression levels of energy/stress and nutritional sensors in PBMCs. (D) Heatmap of senescence marker gene expression in PBMCs. (E) Level of extracellular lactic acid (LA) and SAβ-Gal activity in PBMCs. (F) Quantification of BrdU and ROS (qROS) in PBMCs. Bar and line graphs show the means ± SD. Statistical significance was assessed using Student’s t test for two-group comparisons. p -values are presented as follows: ns (not significant), p ≤ 5 × 10 −1 , ∗p ≤ 5 × 10 −2 , ∗∗p ≤ 5 × 10 −3 , ∗∗∗p ≤ 5 × 10 −4 . Points are shown as empty and mean points as filled circles.

Journal: iScience

Article Title: AKG-TET axis is central to senescence plasticity

doi: 10.1016/j.isci.2025.114298

Figure Lengend Snippet: AKG-TET dependent resilience to damage and protection against damage-induced senescence Proliferating aHDFs (0.3 × 10 6 /mL) and PBMCs (70 years; PBMC 70Yr, 1 × 10 6 /mL) were seeded in culture plates and pre-treated in triplicate without (untreated: UT) or with H 2 O 2 (100 μM) for 24 h. After 24 h, cells were washed and treated without or with CLV (20 μM), or CRISPR TET1 ( TET1 CR ;1 μg/mL). Cells were incubated with 30 μM BrdU for 18 h prior to removal of both the cells and culture media following 7 days of treatment. (A) Expression levels of TETs in PBMCs. (B) AKG bioavailability in PBMCs. (C) Expression levels of energy/stress and nutritional sensors in PBMCs. (D) Heatmap of senescence marker gene expression in PBMCs. (E) Level of extracellular lactic acid (LA) and SAβ-Gal activity in PBMCs. (F) Quantification of BrdU and ROS (qROS) in PBMCs. Bar and line graphs show the means ± SD. Statistical significance was assessed using Student’s t test for two-group comparisons. p -values are presented as follows: ns (not significant), p ≤ 5 × 10 −1 , ∗p ≤ 5 × 10 −2 , ∗∗p ≤ 5 × 10 −3 , ∗∗∗p ≤ 5 × 10 −4 . Points are shown as empty and mean points as filled circles.

Article Snippet: CRISPR activation system for TET1 ( TET1 CR ) , Santa Cruz Biotechnology (Santa Cruz, CA) , sc-400845-ACT-2.

Techniques: CRISPR, Incubation, Expressing, Marker, Gene Expression, Activity Assay

AKG-TET deficient senescence state is reversible Young replicatively proliferating aHDFs (week 3, 0.3 × 10 6 /mL)) were seeded in culture plates and pre-treated in triplicates without (UT) and with C35 (5 μM), RLS (20 μM), or TET1 siRNA ( TET1 i ; 300 nM). Aliquot of cells were incubated with 30 μM BrdU for 18 h prior to removal of both the cells and culture media following 7 days of treatment. The remaining cells were re-seeded in equal numbers and cultured without treatment for an additional 7 days (withdrawal). Cultures were incubated with 30 μM BrdU for 18 h prior to removal of both the cells and culture media. (A) Quantification of TET activity, and 5 mC and 5fc levels. (B) Expression level of energy/stress and nutritional sensor genes. (C) Expression level of NFKB1 , RELA , IKBA , COL1A1, and ELN . (D) γH2AX immunolocalized (cyan) in nuclei. Nuclei stained for DAPI (deep blue) are marked by double hashed lines. (E) Extracellular level of lactic acid (LA), SAβ-Gal activity, LDH toxicity, and UPS. (F) Intracellular level of ROS and 8OHdG. (G) Heatmap of senescence markers and RRM2 gene expression. (H) Rate of proliferation assessed by BrdU incorporation into the nuclei of cells in S-phase. Bar and line graphs show the means ± SD. Boxplots show the first and third quartiles and median values. All points are shown as empty, and mean points as filled circles. The distribution of all data points is shown by Beeswarm in Violin plots. Statistical significance was assessed using Student’s t test for two-group comparisons. p -values are presented as follows: ns (not significant), p ≤ 5 × 10 −1 , ∗p ≤ 5 × 10 −2 , ∗∗p ≤ 5 × 10 −3 , ∗∗∗p ≤ 5 × 10 −4 .

Journal: iScience

Article Title: AKG-TET axis is central to senescence plasticity

doi: 10.1016/j.isci.2025.114298

Figure Lengend Snippet: AKG-TET deficient senescence state is reversible Young replicatively proliferating aHDFs (week 3, 0.3 × 10 6 /mL)) were seeded in culture plates and pre-treated in triplicates without (UT) and with C35 (5 μM), RLS (20 μM), or TET1 siRNA ( TET1 i ; 300 nM). Aliquot of cells were incubated with 30 μM BrdU for 18 h prior to removal of both the cells and culture media following 7 days of treatment. The remaining cells were re-seeded in equal numbers and cultured without treatment for an additional 7 days (withdrawal). Cultures were incubated with 30 μM BrdU for 18 h prior to removal of both the cells and culture media. (A) Quantification of TET activity, and 5 mC and 5fc levels. (B) Expression level of energy/stress and nutritional sensor genes. (C) Expression level of NFKB1 , RELA , IKBA , COL1A1, and ELN . (D) γH2AX immunolocalized (cyan) in nuclei. Nuclei stained for DAPI (deep blue) are marked by double hashed lines. (E) Extracellular level of lactic acid (LA), SAβ-Gal activity, LDH toxicity, and UPS. (F) Intracellular level of ROS and 8OHdG. (G) Heatmap of senescence markers and RRM2 gene expression. (H) Rate of proliferation assessed by BrdU incorporation into the nuclei of cells in S-phase. Bar and line graphs show the means ± SD. Boxplots show the first and third quartiles and median values. All points are shown as empty, and mean points as filled circles. The distribution of all data points is shown by Beeswarm in Violin plots. Statistical significance was assessed using Student’s t test for two-group comparisons. p -values are presented as follows: ns (not significant), p ≤ 5 × 10 −1 , ∗p ≤ 5 × 10 −2 , ∗∗p ≤ 5 × 10 −3 , ∗∗∗p ≤ 5 × 10 −4 .

Article Snippet: CRISPR activation system for TET1 ( TET1 CR ) , Santa Cruz Biotechnology (Santa Cruz, CA) , sc-400845-ACT-2.

Techniques: Incubation, Cell Culture, Activity Assay, Expressing, Staining, Gene Expression, BrdU Incorporation Assay

Activation of the AKG-TET axis reverses replicative and age induced senescence Replicatively induced senescence. Replicatively senescent aHDFs (0.3 × 10 6 cells/mL) were seeded in triplicate in each plate and were treated without (UT) and with RLS (20 μM), CLV (20 μM), or CRISPR TET1 plasmids (TET1 CR , 1 μg/mL). Cells were incubated with 30 μM BrdU for 18 h prior to removal of both the cells and culture media following 7 days of treatment. (A) Expression level of TET s. (B) AKG bioavailability and TET activity (TET act ). (C) Expression level of energy/stress and nutritional sensor gene expression. (D) Intracellular level of ROS. (E) Heatmap of senescence marker and RRM2 gene expression. (F) Level of lactic acid (LA) in culture media. (G) Cellular SAβ-Gal activity. (H) Quantitation of nuclear BrdU. (I) Total cell numbers. Age induced senescence. PBMCs (PBMC 70Yr ) were seeded (1 × 10 6 cells/mL) in triplicate in each well of a 24-well plate and were treated without (UT) and with RLS (20 μM), CLV (20 μM), or CRISPR TET1 plasmids ( TET1 CR : 1 μg/mL). Cells and culture media were removed on day 7 of treatment for analysis. (J) Quantitation of bioavailable AKG and TET activity in cells treated with RLS versus CLV. (K) qPCR quantitation of the expression level of TET s. (L) qPCR quantitation of the expression level of energy/stress and nutritional sensor gene expression. (M) Quantitation of BrdU incorporated into nuclei of cells in S-phase, lactic (LA) acid in culture media, cellular SAβ-Gal activity, and ROS. (N) Heatmap of senescence markers and RRM2 in PBMCs. Bar and line graphs show the means ± SD. Boxplots show the first and third quartiles and median values. All points are shown as empty, and mean points as filled circles. The distribution of all data points is shown by Beeswarm in Violin plots. Statistical significance was assessed using Student’s t test for two-group comparisons. p -values are presented as follows: ns (not significant), p ≤ 5 × 10 −1 , ∗p ≤ 5 × 10 −2 , ∗∗p ≤ 5 × 10 −3 , ∗∗∗p ≤ 5 × 10 −4 , ∗∗∗∗p ≤ 5 × 10 −5 .

Journal: iScience

Article Title: AKG-TET axis is central to senescence plasticity

doi: 10.1016/j.isci.2025.114298

Figure Lengend Snippet: Activation of the AKG-TET axis reverses replicative and age induced senescence Replicatively induced senescence. Replicatively senescent aHDFs (0.3 × 10 6 cells/mL) were seeded in triplicate in each plate and were treated without (UT) and with RLS (20 μM), CLV (20 μM), or CRISPR TET1 plasmids (TET1 CR , 1 μg/mL). Cells were incubated with 30 μM BrdU for 18 h prior to removal of both the cells and culture media following 7 days of treatment. (A) Expression level of TET s. (B) AKG bioavailability and TET activity (TET act ). (C) Expression level of energy/stress and nutritional sensor gene expression. (D) Intracellular level of ROS. (E) Heatmap of senescence marker and RRM2 gene expression. (F) Level of lactic acid (LA) in culture media. (G) Cellular SAβ-Gal activity. (H) Quantitation of nuclear BrdU. (I) Total cell numbers. Age induced senescence. PBMCs (PBMC 70Yr ) were seeded (1 × 10 6 cells/mL) in triplicate in each well of a 24-well plate and were treated without (UT) and with RLS (20 μM), CLV (20 μM), or CRISPR TET1 plasmids ( TET1 CR : 1 μg/mL). Cells and culture media were removed on day 7 of treatment for analysis. (J) Quantitation of bioavailable AKG and TET activity in cells treated with RLS versus CLV. (K) qPCR quantitation of the expression level of TET s. (L) qPCR quantitation of the expression level of energy/stress and nutritional sensor gene expression. (M) Quantitation of BrdU incorporated into nuclei of cells in S-phase, lactic (LA) acid in culture media, cellular SAβ-Gal activity, and ROS. (N) Heatmap of senescence markers and RRM2 in PBMCs. Bar and line graphs show the means ± SD. Boxplots show the first and third quartiles and median values. All points are shown as empty, and mean points as filled circles. The distribution of all data points is shown by Beeswarm in Violin plots. Statistical significance was assessed using Student’s t test for two-group comparisons. p -values are presented as follows: ns (not significant), p ≤ 5 × 10 −1 , ∗p ≤ 5 × 10 −2 , ∗∗p ≤ 5 × 10 −3 , ∗∗∗p ≤ 5 × 10 −4 , ∗∗∗∗p ≤ 5 × 10 −5 .

Article Snippet: CRISPR activation system for TET1 ( TET1 CR ) , Santa Cruz Biotechnology (Santa Cruz, CA) , sc-400845-ACT-2.

Techniques: Activation Assay, CRISPR, Incubation, Expressing, Activity Assay, Gene Expression, Marker, Quantitation Assay

( A ) A schematic representation of the transplantation of DPSC into the first molar tooth after drilling. ( B ) The confirmation of BDNF CRISPR activation plasmid enhanced the expression of pro-BDNF. ( C ) Bar graph showing the integrated intensity of CRISPR-engineered BDNF-activated DPSCs against β-actin compared to control. ( D ) H&E staining of sham control and injured tooth in mouse (n = 6 each group) transplanted with CRISPR-engineered BDNF-overexpressing DPSCs. Scale bar: 100 μm. Figure 4—source data 1. Original files for western blot images displayed in . Figure 4—source data 2. Original files for western blot images displayed in with labeling.

Journal: eLife

Article Title: CRISPR-edited DPSCs constitutively expressing BDNF enhance dentin regeneration in injured teeth

doi: 10.7554/eLife.105153

Figure Lengend Snippet: ( A ) A schematic representation of the transplantation of DPSC into the first molar tooth after drilling. ( B ) The confirmation of BDNF CRISPR activation plasmid enhanced the expression of pro-BDNF. ( C ) Bar graph showing the integrated intensity of CRISPR-engineered BDNF-activated DPSCs against β-actin compared to control. ( D ) H&E staining of sham control and injured tooth in mouse (n = 6 each group) transplanted with CRISPR-engineered BDNF-overexpressing DPSCs. Scale bar: 100 μm. Figure 4—source data 1. Original files for western blot images displayed in . Figure 4—source data 2. Original files for western blot images displayed in with labeling.

Article Snippet: BDNF CRISPR activation plasmid (h) (Cat# sc-400029-ACT) and Reagent System were purchased from Santa Cruz Biotechnology (Dallas).

Techniques: Transplantation Assay, CRISPR, Activation Assay, Plasmid Preparation, Expressing, Control, Staining, Western Blot, Labeling

( A ) Immunohistochemistry was performed to assess GFP-tagged transplanted cells. The white arrow indicates the pulp lining. Scale bar: 100 μm ( B ) Micro-CT image in the sham control of the pulp-capping mouse model. The white arrow indicates the drilling operation, and the dotted line specifies the injured area of dentin. The white box is a magnified image of the injured area. ( C ) The transplantation of CRISPR-engineered BDNF-overexpressing DPSCs in the pulp-capping mouse model. ( D ) Analyzed density of dentin compared with sham control vs. transplantation of CRISPR-engineered BDNF-overexpressing DPSCs in the pulp-capping mouse model (n=5). p<0.05 vs. control.

Journal: eLife

Article Title: CRISPR-edited DPSCs constitutively expressing BDNF enhance dentin regeneration in injured teeth

doi: 10.7554/eLife.105153

Figure Lengend Snippet: ( A ) Immunohistochemistry was performed to assess GFP-tagged transplanted cells. The white arrow indicates the pulp lining. Scale bar: 100 μm ( B ) Micro-CT image in the sham control of the pulp-capping mouse model. The white arrow indicates the drilling operation, and the dotted line specifies the injured area of dentin. The white box is a magnified image of the injured area. ( C ) The transplantation of CRISPR-engineered BDNF-overexpressing DPSCs in the pulp-capping mouse model. ( D ) Analyzed density of dentin compared with sham control vs. transplantation of CRISPR-engineered BDNF-overexpressing DPSCs in the pulp-capping mouse model (n=5). p<0.05 vs. control.

Article Snippet: BDNF CRISPR activation plasmid (h) (Cat# sc-400029-ACT) and Reagent System were purchased from Santa Cruz Biotechnology (Dallas).

Techniques: Immunohistochemistry, Micro-CT, Control, Transplantation Assay, CRISPR

( A ) Representative image of sham control of the pulp-capping mouse model. ( a–j ) Sham control vs. ( k–t ) representative image of the transplantation of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-engineered BDNF-overexpressing DPSCs in the pulp-capping mouse model. Scale bars: 25 and 50 μm. ( B ) Line graphs showing the co-localization of BDNF and GFP [B (e1 and j1)] and of TrkB and GFP [B (o1 and t1)].

Journal: eLife

Article Title: CRISPR-edited DPSCs constitutively expressing BDNF enhance dentin regeneration in injured teeth

doi: 10.7554/eLife.105153

Figure Lengend Snippet: ( A ) Representative image of sham control of the pulp-capping mouse model. ( a–j ) Sham control vs. ( k–t ) representative image of the transplantation of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-engineered BDNF-overexpressing DPSCs in the pulp-capping mouse model. Scale bars: 25 and 50 μm. ( B ) Line graphs showing the co-localization of BDNF and GFP [B (e1 and j1)] and of TrkB and GFP [B (o1 and t1)].

Article Snippet: BDNF CRISPR activation plasmid (h) (Cat# sc-400029-ACT) and Reagent System were purchased from Santa Cruz Biotechnology (Dallas).

Techniques: Control, Transplantation Assay, CRISPR

Proposed interaction of tumor necrosis factor alpha (TNFα) and brain-derived neurotrophic factor (BDNF)/tropomyosin receptor kinase B (TrkB) downstream signaling to modulate odontoblastic differentiation in dental pulp stem cells (DPSCs).

Journal: eLife

Article Title: CRISPR-edited DPSCs constitutively expressing BDNF enhance dentin regeneration in injured teeth

doi: 10.7554/eLife.105153

Figure Lengend Snippet: Proposed interaction of tumor necrosis factor alpha (TNFα) and brain-derived neurotrophic factor (BDNF)/tropomyosin receptor kinase B (TrkB) downstream signaling to modulate odontoblastic differentiation in dental pulp stem cells (DPSCs).

Article Snippet: BDNF CRISPR activation plasmid (h) (Cat# sc-400029-ACT) and Reagent System were purchased from Santa Cruz Biotechnology (Dallas).

Techniques: Derivative Assay

( A ) DUSP22 expression in aged individuals (over 70 years, n = 15) and aged individuals diagnosed with sarcopenia (over 70 years, n = 18), p = 0.0009 (obtained from the Singapore Sarcopenia Study; (GEO accession no. GSE111016 (Migliavacca et al, )). ( B ) DUSP22 expression in C2C12 murine myotubes treated with vehicle or dexamethasone (Dex) to induce atrophy ( n = 3 each) Custer 1 ( p = 0.024), Cluster 2 ( p = 0.13), Cluster 3 ( p = 0.0246). Expression was measured using RNA Seq. TPM=transcript per million. ( C ) qPCR analysis of DUSP22 expression in four models of muscle atrophy: (1) C2C12 myotubes treated with Dex ( n = 5), p = 7.67E−05, (2) the TA muscle of C57BL/6 mice treated with Dex ( n = 4), p = 0.09, (3) the TA muscle of young (5 months-old, n = 9) and geriatric (27 months-old, n = 8) C57BL/6 mice, p = 0.0324, (4) the TA of C57BL/6 mice after hind limb immobilization ( n = 3), p = 0.018. ( D ) qPCR of DUSP22 expression in C2C12 myoblasts transfected with a DUSP22 CRISPR activation plasmid (DUSP22 endo OE) or control plasmid (CON endo OE) ( n = 3), p = 0.0022. ( E ) Fast myosin (MYH2) immunocytochemistry of CON endo OE and DUSP22 endo OE myoblasts after 96 h culture in DM (scale bar = 100 µm). ( F ) Fusion index ( n = 6). ( G ) Differentiation index ( n = 6), p = 9.91E−09. ( H – L ) qPCR analysis of gene expression related to the following: ( H ) Mitochondrial homeostasis (PGC-1α (peroxisome proliferator-activated receptor gamma coactivator 1-alpha, p = 1.44E−05), UCP-3 (mitochondrial uncoupling protein 3, p = 4.61E−05), Acly (ATP citrate lyase, p = 0.5141)) ( n = 4). ( I ) Autophagy (LC-3B (microtubule-associated proteins 1 A/1B light chain 3B, p = 0.0152), CtsL (cathepsin L, p = 4.76E−05)) ( n = 4). ( J ) Ubiquitin-proteasome system (UPS) (UBR2 (ubiquitin protein ligase E3, p = 0.0031), Psmd11 (proteasome 26S subunit, non-ATPase 11, p = 0.1718) ( n = 4). ( K ) Myosin heavy chain levels (slow myosin MYH7, p = 7.23E−06, fast myosin MYH1, p = 0.0171) ( n = 4), and ( L ) FoxO3a-related signaling (FoxO3a ( p = 0.0004), MurF-1 ( p = 0.0019), atrogin-1 ( p = 0.001), p62 ( p = 8.67E−08), TGIF (TGFB induced factor homeobox 1, p = 0.0001), ATF4 (activating transcription factor 4, p = 0.3974), Bnip3 (BCL2/adenovirus E1B 19 kDa protein-interacting protein 3, p = 0.0887); Gadd45a (growth arrest and DNA damage inducible alpha, p = 4.19E−06), SMART (specific of muscle atrophy and regulated by transcription, p = 0.0006), MUSA1 (muscle ubiquitin ligase of SCF complex in atrophy-1, p = 0.2357)) ( n = 4). Box plots represent the distribution of DUSP22 expression levels. The center line indicates the median (50th percentile, Q2), representing the middle value of the dataset. The box bounds correspond to the interquartile range (IQR), extending from the 25th percentile (Q1, lower bound) to the 75th percentile (Q3, upper bound). Whiskers extend to the smallest and largest values within 1.5 × IQR from Q1 and Q3, representing the minimum (lower whisker) and maximum (upper whisker) values within this range. Data points that fall beyond this range are considered outliers and are displayed as individual points outside the whiskers. * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A ) DUSP22 expression in aged individuals (over 70 years, n = 15) and aged individuals diagnosed with sarcopenia (over 70 years, n = 18), p = 0.0009 (obtained from the Singapore Sarcopenia Study; (GEO accession no. GSE111016 (Migliavacca et al, )). ( B ) DUSP22 expression in C2C12 murine myotubes treated with vehicle or dexamethasone (Dex) to induce atrophy ( n = 3 each) Custer 1 ( p = 0.024), Cluster 2 ( p = 0.13), Cluster 3 ( p = 0.0246). Expression was measured using RNA Seq. TPM=transcript per million. ( C ) qPCR analysis of DUSP22 expression in four models of muscle atrophy: (1) C2C12 myotubes treated with Dex ( n = 5), p = 7.67E−05, (2) the TA muscle of C57BL/6 mice treated with Dex ( n = 4), p = 0.09, (3) the TA muscle of young (5 months-old, n = 9) and geriatric (27 months-old, n = 8) C57BL/6 mice, p = 0.0324, (4) the TA of C57BL/6 mice after hind limb immobilization ( n = 3), p = 0.018. ( D ) qPCR of DUSP22 expression in C2C12 myoblasts transfected with a DUSP22 CRISPR activation plasmid (DUSP22 endo OE) or control plasmid (CON endo OE) ( n = 3), p = 0.0022. ( E ) Fast myosin (MYH2) immunocytochemistry of CON endo OE and DUSP22 endo OE myoblasts after 96 h culture in DM (scale bar = 100 µm). ( F ) Fusion index ( n = 6). ( G ) Differentiation index ( n = 6), p = 9.91E−09. ( H – L ) qPCR analysis of gene expression related to the following: ( H ) Mitochondrial homeostasis (PGC-1α (peroxisome proliferator-activated receptor gamma coactivator 1-alpha, p = 1.44E−05), UCP-3 (mitochondrial uncoupling protein 3, p = 4.61E−05), Acly (ATP citrate lyase, p = 0.5141)) ( n = 4). ( I ) Autophagy (LC-3B (microtubule-associated proteins 1 A/1B light chain 3B, p = 0.0152), CtsL (cathepsin L, p = 4.76E−05)) ( n = 4). ( J ) Ubiquitin-proteasome system (UPS) (UBR2 (ubiquitin protein ligase E3, p = 0.0031), Psmd11 (proteasome 26S subunit, non-ATPase 11, p = 0.1718) ( n = 4). ( K ) Myosin heavy chain levels (slow myosin MYH7, p = 7.23E−06, fast myosin MYH1, p = 0.0171) ( n = 4), and ( L ) FoxO3a-related signaling (FoxO3a ( p = 0.0004), MurF-1 ( p = 0.0019), atrogin-1 ( p = 0.001), p62 ( p = 8.67E−08), TGIF (TGFB induced factor homeobox 1, p = 0.0001), ATF4 (activating transcription factor 4, p = 0.3974), Bnip3 (BCL2/adenovirus E1B 19 kDa protein-interacting protein 3, p = 0.0887); Gadd45a (growth arrest and DNA damage inducible alpha, p = 4.19E−06), SMART (specific of muscle atrophy and regulated by transcription, p = 0.0006), MUSA1 (muscle ubiquitin ligase of SCF complex in atrophy-1, p = 0.2357)) ( n = 4). Box plots represent the distribution of DUSP22 expression levels. The center line indicates the median (50th percentile, Q2), representing the middle value of the dataset. The box bounds correspond to the interquartile range (IQR), extending from the 25th percentile (Q1, lower bound) to the 75th percentile (Q3, upper bound). Whiskers extend to the smallest and largest values within 1.5 × IQR from Q1 and Q3, representing the minimum (lower whisker) and maximum (upper whisker) values within this range. Data points that fall beyond this range are considered outliers and are displayed as individual points outside the whiskers. * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Expressing, RNA Sequencing, Transfection, CRISPR, Activation Assay, Plasmid Preparation, Control, Immunocytochemistry, Gene Expression, Ubiquitin Proteomics, Whisker Assay

( A , B ) Expression array profiling of DUSP22, MuRF-1, atrogin-1, and UBR2 expression levels (VST) in a database obtained from muscle biopsies, analyzed using Correlation AnalyzeR. ( C ) qPCR analysis of DUSP22 ( p = 7.22E−09), UBR2 ( p = 0.25), MuRF-1 ( p = 0.0101), atrogin-1 ( p = 0.0005) expression in C2C12 myotubes cultured treated with DM and control siRNA or DUSP22 siRNA for 48 h ( n = 5). ( D ) Fast myosin (MYH2) immunocytochemistry of C2C12 myoblasts cultured as follows: (1) 120 h incubation with DM; (2) 72 h incubation with DM and 48 h incubation with DM plus control, DUSP22 siRNA; (3) Following 72 h incubation with DM, 24 h incubation in with DM plus control, scrambled siRNA and additional 24 h treatment with 10 μM Dex plus siRNA; (4) Following 72 h incubation with DM, 24 h incubation in with DM plus DUSP22 siRNA and additional 24 h treatment with 10 μM Dex plus siRNA (scale bar = 100 μm). ( E ) Myotube diameter ( n = 4, p = siCON (3.01E−05), siDUSP22+Dex (0.0003)). ( F ) Myotube distribution. ( G ) Differentiation index of C2C12 myoblasts treated as in part ( D ) ( n = 4, p = siCON (0.0068), siDUSP22+Dex (0.0037))). ( H ) Fusion index ( n = 4). * p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A , B ) Expression array profiling of DUSP22, MuRF-1, atrogin-1, and UBR2 expression levels (VST) in a database obtained from muscle biopsies, analyzed using Correlation AnalyzeR. ( C ) qPCR analysis of DUSP22 ( p = 7.22E−09), UBR2 ( p = 0.25), MuRF-1 ( p = 0.0101), atrogin-1 ( p = 0.0005) expression in C2C12 myotubes cultured treated with DM and control siRNA or DUSP22 siRNA for 48 h ( n = 5). ( D ) Fast myosin (MYH2) immunocytochemistry of C2C12 myoblasts cultured as follows: (1) 120 h incubation with DM; (2) 72 h incubation with DM and 48 h incubation with DM plus control, DUSP22 siRNA; (3) Following 72 h incubation with DM, 24 h incubation in with DM plus control, scrambled siRNA and additional 24 h treatment with 10 μM Dex plus siRNA; (4) Following 72 h incubation with DM, 24 h incubation in with DM plus DUSP22 siRNA and additional 24 h treatment with 10 μM Dex plus siRNA (scale bar = 100 μm). ( E ) Myotube diameter ( n = 4, p = siCON (3.01E−05), siDUSP22+Dex (0.0003)). ( F ) Myotube distribution. ( G ) Differentiation index of C2C12 myoblasts treated as in part ( D ) ( n = 4, p = siCON (0.0068), siDUSP22+Dex (0.0037))). ( H ) Fusion index ( n = 4). * p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Expressing, Cell Culture, Control, Immunocytochemistry, Incubation

( A ) Western blot analysis of FoxO3a and Akt phosphorylation in C2C12 myotubes treated with control or DUSP22 siRNA in the presence or absence of Dex. ( B ) Quantification of FOXO3a phosphorylation, which is inversely proportional to activity ( n = 6, p-FOXO3A/FOXO3A p =siDUSP22 (7.8E−05), siCON (0.0002), siDUSP22+Dex (0.018), FOXO3A p = siDUSP22 (3.37E−05), siCON (0.0024), siDUSP22+Dex (0.0013)). ( C ) Quantification of Akt phosphorylation, which is directly proportional to activity ( n = 6, p-AKT/AKT p = siDUSP22 (7.8E−05), siCON (0.0002), siDUSP22+Dex (0.018)). ( D ) qPCR analysis of atrogin-1 ( p = siDUSP22 (0.0187), siCON (0.0002), siDUSP22+Dex (0.0451)), MuRF-1 ( p = siDUSP22 (0.0037), siCON (0.0001), siDUSP22+Dex (0.0044)), and DUSP22 ( p =siDUSP22 (1.8E−05), siCON (0.0067), siDUSP22+Dex (2.91E−05)) expression ( n = 6,3). ( E ) Western blot of atrogin-1 and MuRF-1 expression levels. ( F ) Quantification of atrogin-1 ( p = siDUSP22 (0.0125), siCON (0.5.05E−09), siDUSP22+Dex (0.0003)), MuRF-1 ( p = siDUSP22 (0.0226), siCON (0.0033), siDUSP22+Dex (0.0098)), and DUSP22 ( p = siDUSP22 (0.0023), siCON (0.0356), siDUSP22+Dex (0.0353)) levels ( n = 5). ( G ) Fast-type myosin immunostaining of C2C12 myoblasts after culture in DM for 24 h and treatment with control, scrambled siRNA or DUSP22 siRNA for 72 h. Quantification of the fast-type myosin positive myotubes is also shown ( n = 5, p = 0.0001). ( H ) qPCR analysis of DUSP22 ( p = 0.0065), myosin heavy chains (slow myosin MYH7 ( p = 0.0004), fast myosin MYH2 ( p = 0.0024), fast myosin MYH1 ( p = 0.002), and fast myosin MYH4 ( p = 0.0002)), myogenin (MyoG) ( p = 0.0005) and FOXO3a ( p = 0.0171) expression ( n = 3). ( I ) Western blot analysis of MYH2 ( p = 0.015), p-JNK ( p = 0.0316), c-jun ( p = 0.0086), c-jun phosphorylation ( p = 0.0031), atrogin-1 ( p = 0.0333), MuRF-1 ( p = 0.0021), and DUSP22 ( p = 0.0026) (n = 3). ( J ) Quantification of expression and phosphorylation levels. * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A ) Western blot analysis of FoxO3a and Akt phosphorylation in C2C12 myotubes treated with control or DUSP22 siRNA in the presence or absence of Dex. ( B ) Quantification of FOXO3a phosphorylation, which is inversely proportional to activity ( n = 6, p-FOXO3A/FOXO3A p =siDUSP22 (7.8E−05), siCON (0.0002), siDUSP22+Dex (0.018), FOXO3A p = siDUSP22 (3.37E−05), siCON (0.0024), siDUSP22+Dex (0.0013)). ( C ) Quantification of Akt phosphorylation, which is directly proportional to activity ( n = 6, p-AKT/AKT p = siDUSP22 (7.8E−05), siCON (0.0002), siDUSP22+Dex (0.018)). ( D ) qPCR analysis of atrogin-1 ( p = siDUSP22 (0.0187), siCON (0.0002), siDUSP22+Dex (0.0451)), MuRF-1 ( p = siDUSP22 (0.0037), siCON (0.0001), siDUSP22+Dex (0.0044)), and DUSP22 ( p =siDUSP22 (1.8E−05), siCON (0.0067), siDUSP22+Dex (2.91E−05)) expression ( n = 6,3). ( E ) Western blot of atrogin-1 and MuRF-1 expression levels. ( F ) Quantification of atrogin-1 ( p = siDUSP22 (0.0125), siCON (0.5.05E−09), siDUSP22+Dex (0.0003)), MuRF-1 ( p = siDUSP22 (0.0226), siCON (0.0033), siDUSP22+Dex (0.0098)), and DUSP22 ( p = siDUSP22 (0.0023), siCON (0.0356), siDUSP22+Dex (0.0353)) levels ( n = 5). ( G ) Fast-type myosin immunostaining of C2C12 myoblasts after culture in DM for 24 h and treatment with control, scrambled siRNA or DUSP22 siRNA for 72 h. Quantification of the fast-type myosin positive myotubes is also shown ( n = 5, p = 0.0001). ( H ) qPCR analysis of DUSP22 ( p = 0.0065), myosin heavy chains (slow myosin MYH7 ( p = 0.0004), fast myosin MYH2 ( p = 0.0024), fast myosin MYH1 ( p = 0.002), and fast myosin MYH4 ( p = 0.0002)), myogenin (MyoG) ( p = 0.0005) and FOXO3a ( p = 0.0171) expression ( n = 3). ( I ) Western blot analysis of MYH2 ( p = 0.015), p-JNK ( p = 0.0316), c-jun ( p = 0.0086), c-jun phosphorylation ( p = 0.0031), atrogin-1 ( p = 0.0333), MuRF-1 ( p = 0.0021), and DUSP22 ( p = 0.0026) (n = 3). ( J ) Quantification of expression and phosphorylation levels. * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Western Blot, Phospho-proteomics, Control, Activity Assay, Expressing, Immunostaining

( A ) Chemical structure of BML-260 and CB-Dock2 modeling of BML-260 binding to the active site of human DUSP22 (Pocket C5 and score -5.8. Chain A: GLY-1, PRO0, ASP57, CYS88, LEU89, ALA90, GLY91, VAL92, SER93, ARG94, SER123, CYS124, ALA125, ASN126, ASN128). ( B ) Fast myosin (MYH2) immunostaning of C2C12 myoblasts cultured as follows: (1) DM for 120 h (untreated); (2) DM for 96 h and DM plus 10 μM Dex for 24 h; (3) DM for 96 h and DM plus 10 μM Dex and 12.5 μM BML-260 for 24 h (scale bar = 100 μm). ( C ) Mean myotube diameter ( n = 4, p = (Vehicle = 0.0038), (BML-260 = 0.0051)). ( D ) Myotube diameter distribution. ( E ) Fusion index ( n = 3). ( F ) Differentiation index ( n = 3, p = (Vehicle = 0.0731), (BML-260 = 0.0282)). ( G ) SUnSET assay of protein synthesis rate measuring puromycin incorporation ( n = 3). ( H ) Quantification of the SUnSET assay ( p = (Vehicle = 0.0747), (BML-260 = 0.0401)). ( I ) qPCR analysis of atrogin-1 ( p = (Vehicle = 7.65E−07), (BML-260 = 0.0194)) and MuRF-1( p = (Vehicle = 7.01E−06), (BML-260 = 0.112)) expression ( n = 12). ( J ) Western blot analysis of atrogin-1, MuRF-1, and DUSP22. ( K – M ) Quantification of atrogin-1 ( p = Vehicle (3.74E−09), Dex+BML-260 (0.0016)), MuRF-1 ( p = Vehicle (0.0002), Dex+BML-260 (0.0025)) ( n = 6) and DUSP22 ( p = Vehicle (0.0029), Dex+BML-260 (0.0737)) ( n = 3). *= p < 0.05, **= p < 0.01, and ****= p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A ) Chemical structure of BML-260 and CB-Dock2 modeling of BML-260 binding to the active site of human DUSP22 (Pocket C5 and score -5.8. Chain A: GLY-1, PRO0, ASP57, CYS88, LEU89, ALA90, GLY91, VAL92, SER93, ARG94, SER123, CYS124, ALA125, ASN126, ASN128). ( B ) Fast myosin (MYH2) immunostaning of C2C12 myoblasts cultured as follows: (1) DM for 120 h (untreated); (2) DM for 96 h and DM plus 10 μM Dex for 24 h; (3) DM for 96 h and DM plus 10 μM Dex and 12.5 μM BML-260 for 24 h (scale bar = 100 μm). ( C ) Mean myotube diameter ( n = 4, p = (Vehicle = 0.0038), (BML-260 = 0.0051)). ( D ) Myotube diameter distribution. ( E ) Fusion index ( n = 3). ( F ) Differentiation index ( n = 3, p = (Vehicle = 0.0731), (BML-260 = 0.0282)). ( G ) SUnSET assay of protein synthesis rate measuring puromycin incorporation ( n = 3). ( H ) Quantification of the SUnSET assay ( p = (Vehicle = 0.0747), (BML-260 = 0.0401)). ( I ) qPCR analysis of atrogin-1 ( p = (Vehicle = 7.65E−07), (BML-260 = 0.0194)) and MuRF-1( p = (Vehicle = 7.01E−06), (BML-260 = 0.112)) expression ( n = 12). ( J ) Western blot analysis of atrogin-1, MuRF-1, and DUSP22. ( K – M ) Quantification of atrogin-1 ( p = Vehicle (3.74E−09), Dex+BML-260 (0.0016)), MuRF-1 ( p = Vehicle (0.0002), Dex+BML-260 (0.0025)) ( n = 6) and DUSP22 ( p = Vehicle (0.0029), Dex+BML-260 (0.0737)) ( n = 3). *= p < 0.05, **= p < 0.01, and ****= p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Binding Assay, Cell Culture, Expressing, Western Blot

( A ) Schematic of the experimental protocol. ( B ) Western blot analysis of DUSP22 in the Dex-treated tibialis anterior (TA) muscle 3 d after delivery of control or DUSP22 siRNA ( n = 3). ( C ) Quantification of DUSP22 expression ( n = 3, p = 0.0308). ( D ) TA muscle mass ( n = 4, p = (siCON = 0.006, siDUSP22+Dex = 0.0042)). ( E ) Representative H&E staining, and myosin heavy chain IIa (MYHIIa; type 2 A) and IIb (MYHIIb; type 2B) immunostaining of the TA muscle. ( F ) TA myofiber CSA ( n = 4, p = ((siCON = 1.34E−30, siDUSP22+Dex = 1.31E−22)). At least 80 fibers were measured for each sample ( G ) TA myofiber area distribution. ( H ) Type 2A myofiber distribution. ( I ) Type 2B myofiber distribution. ( J ) Western blot analysis of phosphorylated FOXO3a (p-FOXO3a), FOXO3a, phosphorylated c-jun (p-c-jun), c-jun, phosphorylated JNK (p-JNK), JNK in the TA muscle ( n = 4). ( K ) Quantification of p-FOXO3a ( p = ((siCON = 0.0958, siDUSP22+Dex = 0.0255)), FOXO3a ( p = ((siCON = 0.0068, siDUSP22+Dex = 0.0.001)), P-JNK ( p = ((siCON = 0.1087, siDUSP22+Dex = 0.1271)), and JNK ( p = ((siCON = 1.61E−05, siDUSP22+Dex = 0.0004)). ( L ) Quantification of P-c-jun ( p = ((siCON = 0.5016, siDUSP22+Dex = 0.0017)) and c-jun ( p = ((siCON = 6.27E−06, siDUSP22+Dex = 3.52E−06)). GAPDH was used for the normalization of FOXO3a, p-JNK, JNK, p-c-Jun and c-Jun expression. FOXO3a was used for the normalization of p-FOXO3a expression. ( M ) Western blot analysis of p62 ( p = ((siCON = 0.0297, siDUSP22+Dex = 0.0042)) and MuRF-1 ( p = ((siCON = 0.1484, siDUSP22+Dex = 0.0245)) ( n = 4). GAPDH was used for normalization of expression. ( N ) Quantification of p62 and MuRF-1. * p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A ) Schematic of the experimental protocol. ( B ) Western blot analysis of DUSP22 in the Dex-treated tibialis anterior (TA) muscle 3 d after delivery of control or DUSP22 siRNA ( n = 3). ( C ) Quantification of DUSP22 expression ( n = 3, p = 0.0308). ( D ) TA muscle mass ( n = 4, p = (siCON = 0.006, siDUSP22+Dex = 0.0042)). ( E ) Representative H&E staining, and myosin heavy chain IIa (MYHIIa; type 2 A) and IIb (MYHIIb; type 2B) immunostaining of the TA muscle. ( F ) TA myofiber CSA ( n = 4, p = ((siCON = 1.34E−30, siDUSP22+Dex = 1.31E−22)). At least 80 fibers were measured for each sample ( G ) TA myofiber area distribution. ( H ) Type 2A myofiber distribution. ( I ) Type 2B myofiber distribution. ( J ) Western blot analysis of phosphorylated FOXO3a (p-FOXO3a), FOXO3a, phosphorylated c-jun (p-c-jun), c-jun, phosphorylated JNK (p-JNK), JNK in the TA muscle ( n = 4). ( K ) Quantification of p-FOXO3a ( p = ((siCON = 0.0958, siDUSP22+Dex = 0.0255)), FOXO3a ( p = ((siCON = 0.0068, siDUSP22+Dex = 0.0.001)), P-JNK ( p = ((siCON = 0.1087, siDUSP22+Dex = 0.1271)), and JNK ( p = ((siCON = 1.61E−05, siDUSP22+Dex = 0.0004)). ( L ) Quantification of P-c-jun ( p = ((siCON = 0.5016, siDUSP22+Dex = 0.0017)) and c-jun ( p = ((siCON = 6.27E−06, siDUSP22+Dex = 3.52E−06)). GAPDH was used for the normalization of FOXO3a, p-JNK, JNK, p-c-Jun and c-Jun expression. FOXO3a was used for the normalization of p-FOXO3a expression. ( M ) Western blot analysis of p62 ( p = ((siCON = 0.0297, siDUSP22+Dex = 0.0042)) and MuRF-1 ( p = ((siCON = 0.1484, siDUSP22+Dex = 0.0245)) ( n = 4). GAPDH was used for normalization of expression. ( N ) Quantification of p62 and MuRF-1. * p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Western Blot, Control, Expressing, Staining, Immunostaining

( A , B ) Western blot and densitometry analysis of AKT phosphorylation in the Dex-treated tibialis anterior (TA) muscle 3 d after delivery of control or DUSP22 siRNA ( n = 4) ( p = (siCON = 0.029, siDUSP22+Dex = 0.0412)). GAPDH was used for normalization of expression. * p < 0.05 indicate significantly increased or decreased. n represents biological replicates analyzed by Student’s t test. Error bars represent the standard error of the mean (SEM). .

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A , B ) Western blot and densitometry analysis of AKT phosphorylation in the Dex-treated tibialis anterior (TA) muscle 3 d after delivery of control or DUSP22 siRNA ( n = 4) ( p = (siCON = 0.029, siDUSP22+Dex = 0.0412)). GAPDH was used for normalization of expression. * p < 0.05 indicate significantly increased or decreased. n represents biological replicates analyzed by Student’s t test. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Western Blot, Phospho-proteomics, Control, Expressing

( A ) Tetanic muscle contraction measurement in the TA muscle of aged ( n = 3) ( p = 0.3974) or middle aged mice ( n = 4) ( p = 0.0807) 3 d after the delivery of control or DUSP22 siRNA. ( B ) Twitch force measure in 15-month-old mice 3 d after the delivery of control or DUSP22 siRNA ( n = 4) ( p = 0.1054, 0.1677, 0.1964, 0.1858, 0.2118, 0.234, 0.2489, 0.2684, 0.2947). n represents biological replicates analyzed by Student’s t test. Error bars represent the standard error of the mean (SEM). .

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A ) Tetanic muscle contraction measurement in the TA muscle of aged ( n = 3) ( p = 0.3974) or middle aged mice ( n = 4) ( p = 0.0807) 3 d after the delivery of control or DUSP22 siRNA. ( B ) Twitch force measure in 15-month-old mice 3 d after the delivery of control or DUSP22 siRNA ( n = 4) ( p = 0.1054, 0.1677, 0.1964, 0.1858, 0.2118, 0.234, 0.2489, 0.2684, 0.2947). n represents biological replicates analyzed by Student’s t test. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Control

( A ) Schematic of the experimental protocol. ( B ) Body weight during 13 d treatment with vehicle, 15 mg/kg Dex, or 15 mg/kg Dex and 5 mg/kg BML-260. ( C ) Grip strength ( n = 4, p = (Vehicle = 0.3426, BML-260 = 0.224). ( D ) Rotarod performance in the constant (RPM) ( p = (Vehicle = 0.05, BML-260 = 0.0263)) and acceleration (latency to fall) ( p = (Vehicle = 0.0003, BML-260 = 0.0132)) models ( n = 4). ( E ) Representative H&E staining of the gastrocnemius muscle. ( F ) Myofiber CSA ( n = 4, p = (Vehicle = 1.98E−84, BML-260 = 2.93E−32)). ( G ) Myofiber area distribution. At least 100 fibers were measured for each sample ( H ) TA muscle mass ( n = 4, p = (Vehicle = 0.0042, BML-260 = 0.0208)). ( I , J ) Western blot analysis of atrogin-1 ( p = (Vehicle = 0.0029, BML-260 = 0.0014)), MuRF-1 ( p = (Vehicle = 0.0086, BML-260 = 0.0498)), and DUSP22 ( p = (Vehicle = 0.0034, BML-260 = 0.0258)) expression in the TA muscle ( n = 3). GAPDH was used for normalization of expression. * p < 0.05, ** p < 0.01, and **** p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A ) Schematic of the experimental protocol. ( B ) Body weight during 13 d treatment with vehicle, 15 mg/kg Dex, or 15 mg/kg Dex and 5 mg/kg BML-260. ( C ) Grip strength ( n = 4, p = (Vehicle = 0.3426, BML-260 = 0.224). ( D ) Rotarod performance in the constant (RPM) ( p = (Vehicle = 0.05, BML-260 = 0.0263)) and acceleration (latency to fall) ( p = (Vehicle = 0.0003, BML-260 = 0.0132)) models ( n = 4). ( E ) Representative H&E staining of the gastrocnemius muscle. ( F ) Myofiber CSA ( n = 4, p = (Vehicle = 1.98E−84, BML-260 = 2.93E−32)). ( G ) Myofiber area distribution. At least 100 fibers were measured for each sample ( H ) TA muscle mass ( n = 4, p = (Vehicle = 0.0042, BML-260 = 0.0208)). ( I , J ) Western blot analysis of atrogin-1 ( p = (Vehicle = 0.0029, BML-260 = 0.0014)), MuRF-1 ( p = (Vehicle = 0.0086, BML-260 = 0.0498)), and DUSP22 ( p = (Vehicle = 0.0034, BML-260 = 0.0258)) expression in the TA muscle ( n = 3). GAPDH was used for normalization of expression. * p < 0.05, ** p < 0.01, and **** p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Staining, Western Blot, Expressing

( A ) Experimental protocol to knockdown DUSP22 expression in the TA of aged mice. ( B ) Western blot analysis of DUSP22 and MuRF-1 and expression levels ( n = 4). GAPDH was used for normalization of expression. ( C ) Quantification of DUSP22 ( p = (3 M = 0.0004, 27 M+siDUSP22 = 0.0007)) and MuRF-1 ( p = (3 M = 0.0148, 27 M+siDUSP22 = 0.0046)). ( D ) Change in TA muscle mass ( p = 0.1749) over the course of the experiment. ( E ) Representative H&E staining of the TA muscle. ( F ) TA myofiber CSA ( n = 5, p = 7.54E−35). At least 150 fibers were measured for each sample ( G ) Western blot of FOXO3a, atrogin-1, MuRF-1, and DUSP22 levels in the TA muscle from the control siRNA treated left and DUSP22 siRNA treated right leg ( n = 4). ( H ) Change in FOXO3a ( p = 0.1852), atrogin-1 ( p = 0.0532), and MuRF-1 ( p = 0.0052), DUSP22 ( p = 0.1466) expression relative to GAPDH. ( I ) Experimental protocol for DUSP22 pharmacological targeting in aged mice. ( J ) Body weight over the course of the experiment. ( K ) Grip strength ( p = (5 M = 0.0002, Aged+BML-260 = 0.0702) and rotarod performance ( p = 0.0381) in the latency to fall test ( n = 5,4). ( L ) Mass of the quadriceps ( p = (5 M = 0.0002, Aged+BML-260 = 0.0539), gastrocnemius ( p = (5 M = 0.0003, Aged+BML-260 = 0.0383), TA ( p = (5 M = 0.0229, Aged+BML-260 = 0.04919) and soleus ( p = (5 M = 0.1484, Aged+BML-260 = 0.2699) muscles ( n = 5). ( M ) qPCR analysis of MuRF-1( p = 0.0194) and atrogin-1 ( p = 0.0737) expression ( n = 3,4). ( N ) qPCR analysis of myostatin (Mstn) ( p = 0.0072) and PGC-1α ( p = 0.0423) expression ( n = 3,4). ( O ) MYHIIa (type 2a), MYHIIb (type 2b), and MYHIIx (type 2x), DAPI and laminin staining in the TA and gastrocnemius muscles (5 M = 5 months-old). Scale bar = 100 µm. ( P ) CSA of the type 2a ( p = (5 M = 0.0016, Aged+BML-260 = 0.1403), 2b ( p = (5 M = < 0.0001, Aged+BML-260 = 0.0004), and 2x ( p = (5 M = 0.001, Aged+BML-260 = 0.005) myofibers ( n = 4). ( Q ) Minimal Feret’s diameter of the type 2a ( p = (5 M = 0.0057, Aged+BML-260 = 0.0662), 2b ( p = (5 M = < 0.0001, Aged+BML-260 = 0.0017), and 2x ( p = (5 M = 0.0092, Aged+BML-260 = 0.0155) myofibers. * p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A ) Experimental protocol to knockdown DUSP22 expression in the TA of aged mice. ( B ) Western blot analysis of DUSP22 and MuRF-1 and expression levels ( n = 4). GAPDH was used for normalization of expression. ( C ) Quantification of DUSP22 ( p = (3 M = 0.0004, 27 M+siDUSP22 = 0.0007)) and MuRF-1 ( p = (3 M = 0.0148, 27 M+siDUSP22 = 0.0046)). ( D ) Change in TA muscle mass ( p = 0.1749) over the course of the experiment. ( E ) Representative H&E staining of the TA muscle. ( F ) TA myofiber CSA ( n = 5, p = 7.54E−35). At least 150 fibers were measured for each sample ( G ) Western blot of FOXO3a, atrogin-1, MuRF-1, and DUSP22 levels in the TA muscle from the control siRNA treated left and DUSP22 siRNA treated right leg ( n = 4). ( H ) Change in FOXO3a ( p = 0.1852), atrogin-1 ( p = 0.0532), and MuRF-1 ( p = 0.0052), DUSP22 ( p = 0.1466) expression relative to GAPDH. ( I ) Experimental protocol for DUSP22 pharmacological targeting in aged mice. ( J ) Body weight over the course of the experiment. ( K ) Grip strength ( p = (5 M = 0.0002, Aged+BML-260 = 0.0702) and rotarod performance ( p = 0.0381) in the latency to fall test ( n = 5,4). ( L ) Mass of the quadriceps ( p = (5 M = 0.0002, Aged+BML-260 = 0.0539), gastrocnemius ( p = (5 M = 0.0003, Aged+BML-260 = 0.0383), TA ( p = (5 M = 0.0229, Aged+BML-260 = 0.04919) and soleus ( p = (5 M = 0.1484, Aged+BML-260 = 0.2699) muscles ( n = 5). ( M ) qPCR analysis of MuRF-1( p = 0.0194) and atrogin-1 ( p = 0.0737) expression ( n = 3,4). ( N ) qPCR analysis of myostatin (Mstn) ( p = 0.0072) and PGC-1α ( p = 0.0423) expression ( n = 3,4). ( O ) MYHIIa (type 2a), MYHIIb (type 2b), and MYHIIx (type 2x), DAPI and laminin staining in the TA and gastrocnemius muscles (5 M = 5 months-old). Scale bar = 100 µm. ( P ) CSA of the type 2a ( p = (5 M = 0.0016, Aged+BML-260 = 0.1403), 2b ( p = (5 M = < 0.0001, Aged+BML-260 = 0.0004), and 2x ( p = (5 M = 0.001, Aged+BML-260 = 0.005) myofibers ( n = 4). ( Q ) Minimal Feret’s diameter of the type 2a ( p = (5 M = 0.0057, Aged+BML-260 = 0.0662), 2b ( p = (5 M = < 0.0001, Aged+BML-260 = 0.0017), and 2x ( p = (5 M = 0.0092, Aged+BML-260 = 0.0155) myofibers. * p < 0.05, ** p < 0.01, *** p < 0.001 and **** p < 0.0001 indicate significantly increased or decreased. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Knockdown, Expressing, Western Blot, Staining, Control, Muscles

( A ) Western blot analysis of DUSP22 expression in the TA of aged mice treated with BML-260 ( n = 4,3) ( p = (Young = 0.0362, Aged+BML-260 = 0.0054)). GAPDH was used for normalization of expression. * p < 0.05 and ** p < 0.01 indicate significantly increased or decreased. ( B , C ) Western blot analysis of DUSP22 expression in the TA ( n = 3,5,6) ( p = (Sham = 0.0051, BML-260 = 0.0488)) ( B ) and gastrocnemius muscle ( n = 3,5,6) ( p = (Sham=0.6845, BML-260 = 0.0008)) ( C ) of immobilized (IMM) mice treated with BML-260. For the TA muscle, MYH4 (myosin heavy chain 2B) ( p = (Sham=0.0253, BML-260 = 0.0288)) levels are also shown. GAPDH was used for normalization of expression. * p < 0.05, ** p < 0.01, and *** p < 0.001 indicate significantly increased or decreased. n represents biological replicates analyzed by Student’s t test. Error bars represent the standard error of the mean (SEM). .

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A ) Western blot analysis of DUSP22 expression in the TA of aged mice treated with BML-260 ( n = 4,3) ( p = (Young = 0.0362, Aged+BML-260 = 0.0054)). GAPDH was used for normalization of expression. * p < 0.05 and ** p < 0.01 indicate significantly increased or decreased. ( B , C ) Western blot analysis of DUSP22 expression in the TA ( n = 3,5,6) ( p = (Sham = 0.0051, BML-260 = 0.0488)) ( B ) and gastrocnemius muscle ( n = 3,5,6) ( p = (Sham=0.6845, BML-260 = 0.0008)) ( C ) of immobilized (IMM) mice treated with BML-260. For the TA muscle, MYH4 (myosin heavy chain 2B) ( p = (Sham=0.0253, BML-260 = 0.0288)) levels are also shown. GAPDH was used for normalization of expression. * p < 0.05, ** p < 0.01, and *** p < 0.001 indicate significantly increased or decreased. n represents biological replicates analyzed by Student’s t test. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Western Blot, Expressing

( A ) Effect of immobilization on skeletal muscle mass using the plastic EP tube method ( n = 3). ( B ) qPCR analysis of DUSP22 expression in the TA muscle (IM = immobilized) ( n = 3) ( p = 0.018). ( C ) Plot of DUSP22 expression in relation to TA mass ( n = 6). ( D ) Western blot analysis of DUSP22 expression ( n = 3) ( p = 0.1699). ( E ) TA mass ( n = 9,7) ( p = (Sham = <0.0001, BML-260 = 0.007)). ( F ) Western blot analysis of atrogin-1( p = (Sham = 0.0005, BML-260 = 0.0009)), MuRF-1 ( p = (Sham = 0.008, BML-260 = 0.0057)), and DUSP22 ( p = (Sham = 0.0007, BML-260 = 0.054)) levels in the TA muscle ( n = 3). Quantification of atrogin-1, MuRF-1, and DUSP22 levels relative to GAPDH are also shown. ( G ) Micrographs of MYH2-immunostained human myotubes treated as follows: 1) Vehicle alone, 2) 10 μM Dex for 24 h, 3) 10 μM Dex and 12.5 μM BML-260 for 24 h. ( H ) Mean myotube diameter ( n = 5,4) ( p = (Vehicle = 0.0001, BML-260 = 0.033)). ( I ) Micrographs of MYH2-immunostained human myotubes treated as follows: (1) 48 h incubation in with DM plus control, scrambled siRNA; (2) 48 h incubation with DM plus DUSP22 siRNA: (3) 24 h incubation with DM plus control, scrambled siRNA and additional 24 h treatment with 10 μM Dex plus siRNA; (4) 24 h incubation with DM plus DUSP22 siRNA and additional 24 h treatment with 10 μM Dex plus siRNA. ( J ) Myotube diameter ( n = 7,5) ( p = (siCON = 9.79E−06., siDUSP22+Dex = 0.0003)). ( K ) qPCR analysis of DUSP22 expression in the Dex-treated human myotubes ( n = 3) ( p = 0.0129). ( L ) qPCR analysis of MuRF-1( p = (siCON = 0.0286, siDUSP22+Dex = 0.049)) expression in the Dex-treated human myotubes ( n = 3). * p < 0.05, ** p < 0.01, and *** p < 0.001 indicate significantly increased or decreased. ( M ) Working model of the effect of DUSP22 targeting on skeletal muscle atrophy: 1) In healthy muscle, Akt signaling can promote hypertrophy by increasing protein synthesis and inhibiting the activity of FOXO3a. 2) In the context of skeletal muscle wasting, the Akt pathway can become suppressed and FOXO3a signaling is upregulated. The results from this study show that targeting DUSP22 in wasting muscle downregulates JNK and reduces FOXO3a signaling. These events occur independently of Akt signaling activation, which remains suppressed. DUSP22 targeting, via pharmacology or gene knockdown, is sufficient to enhance function, improve histopathology, and lower atrogene expression in multiple forms of skeletal muscle wasting. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: ( A ) Effect of immobilization on skeletal muscle mass using the plastic EP tube method ( n = 3). ( B ) qPCR analysis of DUSP22 expression in the TA muscle (IM = immobilized) ( n = 3) ( p = 0.018). ( C ) Plot of DUSP22 expression in relation to TA mass ( n = 6). ( D ) Western blot analysis of DUSP22 expression ( n = 3) ( p = 0.1699). ( E ) TA mass ( n = 9,7) ( p = (Sham = <0.0001, BML-260 = 0.007)). ( F ) Western blot analysis of atrogin-1( p = (Sham = 0.0005, BML-260 = 0.0009)), MuRF-1 ( p = (Sham = 0.008, BML-260 = 0.0057)), and DUSP22 ( p = (Sham = 0.0007, BML-260 = 0.054)) levels in the TA muscle ( n = 3). Quantification of atrogin-1, MuRF-1, and DUSP22 levels relative to GAPDH are also shown. ( G ) Micrographs of MYH2-immunostained human myotubes treated as follows: 1) Vehicle alone, 2) 10 μM Dex for 24 h, 3) 10 μM Dex and 12.5 μM BML-260 for 24 h. ( H ) Mean myotube diameter ( n = 5,4) ( p = (Vehicle = 0.0001, BML-260 = 0.033)). ( I ) Micrographs of MYH2-immunostained human myotubes treated as follows: (1) 48 h incubation in with DM plus control, scrambled siRNA; (2) 48 h incubation with DM plus DUSP22 siRNA: (3) 24 h incubation with DM plus control, scrambled siRNA and additional 24 h treatment with 10 μM Dex plus siRNA; (4) 24 h incubation with DM plus DUSP22 siRNA and additional 24 h treatment with 10 μM Dex plus siRNA. ( J ) Myotube diameter ( n = 7,5) ( p = (siCON = 9.79E−06., siDUSP22+Dex = 0.0003)). ( K ) qPCR analysis of DUSP22 expression in the Dex-treated human myotubes ( n = 3) ( p = 0.0129). ( L ) qPCR analysis of MuRF-1( p = (siCON = 0.0286, siDUSP22+Dex = 0.049)) expression in the Dex-treated human myotubes ( n = 3). * p < 0.05, ** p < 0.01, and *** p < 0.001 indicate significantly increased or decreased. ( M ) Working model of the effect of DUSP22 targeting on skeletal muscle atrophy: 1) In healthy muscle, Akt signaling can promote hypertrophy by increasing protein synthesis and inhibiting the activity of FOXO3a. 2) In the context of skeletal muscle wasting, the Akt pathway can become suppressed and FOXO3a signaling is upregulated. The results from this study show that targeting DUSP22 in wasting muscle downregulates JNK and reduces FOXO3a signaling. These events occur independently of Akt signaling activation, which remains suppressed. DUSP22 targeting, via pharmacology or gene knockdown, is sufficient to enhance function, improve histopathology, and lower atrogene expression in multiple forms of skeletal muscle wasting. n represents biological replicates. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Expressing, Western Blot, Incubation, Control, Activity Assay, Activation Assay, Knockdown, Histopathology

Western blot analysis of DUSP22 ( p = (Sham = 0.0341, BML-260 = 0.0494)), JNK and phosphorylated JNK (JNK-P) ( p = (Sham = 0.0052, BML-260 = 0.0007)) levels in the TA muscle of immobilized mice ( n = 3,4). GAPDH was used for normalization of expression. * p < 0.05, ** p < 0.01, and *** p < 0.001 indicate significantly increased or decreased. n represents biological replicates analyzed by Student’s t test. Error bars represent the standard error of the mean (SEM). .

Journal: EMBO Molecular Medicine

Article Title: Modulating phosphatase DUSP22 with BML-260 ameliorates skeletal muscle wasting via Akt independent JNK-FOXO3a repression

doi: 10.1038/s44321-025-00234-2

Figure Lengend Snippet: Western blot analysis of DUSP22 ( p = (Sham = 0.0341, BML-260 = 0.0494)), JNK and phosphorylated JNK (JNK-P) ( p = (Sham = 0.0052, BML-260 = 0.0007)) levels in the TA muscle of immobilized mice ( n = 3,4). GAPDH was used for normalization of expression. * p < 0.05, ** p < 0.01, and *** p < 0.001 indicate significantly increased or decreased. n represents biological replicates analyzed by Student’s t test. Error bars represent the standard error of the mean (SEM). .

Article Snippet: To induce endogenous overexpression, C2C12 myoblasts were transfected with a DUSP22 CRISPR activation plasmid (Santa Cruz, SC-430587-ACT, sequence: TGCAGTTTGCGCACGCGCGC).

Techniques: Western Blot, Expressing

Effects of Pas2r12 or Pas2r12–cargo protein complex-mediated stimulation on INSR/IGF1R and ERK1/2. HEK293 cells were pretreated with dimethyl sulfoxide (linsitinib [−]) or with linsitinib (linsitinib [+]) and subsequently stimulated with Pas2r12, Pas2r12–EGFP, Pas2r12–IgG, or insulin for 2 min ( A – C ) or 10 min ( D – F ). Panels A and D show representative Western blot images. Panels B and E display the phosphorylation levels of INSR/IGF1R (pINSR/pIGF1R); panels C and F show the phosphorylation levels of ERK1/2 (pERK1/2); all values were normalized to GAPDH. Phosphorylation levels were analyzed and compared with the solvent control (DMEM only, linsitinib [−]) using Student’s t -test. For each treatment condition, linsitinib (+) was compared with the corresponding linsitinib (−) condition. Statistically significant differences compared with the control are indicated on the bar graphs; significant differences between linsitinib (+) and linsitinib (−) treatments are marked by horizontal lines. Statistical comparisons were performed against control cells using Student’s t -test. Error bars indicate the standard error of the mean (SEM). * p < 0.05 and ** p < 0.01. N = 4.

Journal: Pharmaceuticals

Article Title: Role of the Insulin Receptor in Mediating Cytosolic Delivery of Proteins by a Modified Cell-Penetrating Peptide

doi: 10.3390/ph18121885

Figure Lengend Snippet: Effects of Pas2r12 or Pas2r12–cargo protein complex-mediated stimulation on INSR/IGF1R and ERK1/2. HEK293 cells were pretreated with dimethyl sulfoxide (linsitinib [−]) or with linsitinib (linsitinib [+]) and subsequently stimulated with Pas2r12, Pas2r12–EGFP, Pas2r12–IgG, or insulin for 2 min ( A – C ) or 10 min ( D – F ). Panels A and D show representative Western blot images. Panels B and E display the phosphorylation levels of INSR/IGF1R (pINSR/pIGF1R); panels C and F show the phosphorylation levels of ERK1/2 (pERK1/2); all values were normalized to GAPDH. Phosphorylation levels were analyzed and compared with the solvent control (DMEM only, linsitinib [−]) using Student’s t -test. For each treatment condition, linsitinib (+) was compared with the corresponding linsitinib (−) condition. Statistically significant differences compared with the control are indicated on the bar graphs; significant differences between linsitinib (+) and linsitinib (−) treatments are marked by horizontal lines. Statistical comparisons were performed against control cells using Student’s t -test. Error bars indicate the standard error of the mean (SEM). * p < 0.05 and ** p < 0.01. N = 4.

Article Snippet: Transfection was performed using Lipofectamine 3000 with 5 μg of the IGF1R CRISPR Activation Plasmid (sc-400084-ACT; Santa Cruz Biotechnology).

Techniques: Western Blot, Phospho-proteomics, Solvent, Control

Effect of IGF1R and INSR knockdown on the Pas2r12-mediated cytosolic delivery of EGFP. Western blot analyses ( A – C ) and confocal laser scanning microscopy images ( D , E ). Graphs B and C show IGF1R and INSR expression levels, respectively, normalized to GAPDH. Cells analyzed with confocal laser scanning microscopy in panel A were analyzed by Western blot ( A – C ). ( D ) Pas2r12-mediated cytosolic delivery of EGFP in knockdown cells, with EGFP fluorescence shown in green, and ( E ) percentage of cells exhibiting cytosolic EGFP delivery. Scale bars represent 20 μm. Statistical comparisons were performed against siNC cells using Student’s t -test. Error bars indicate the standard error of the mean (SEM). * p < 0.05, *** p < 0.001. N = 4.

Journal: Pharmaceuticals

Article Title: Role of the Insulin Receptor in Mediating Cytosolic Delivery of Proteins by a Modified Cell-Penetrating Peptide

doi: 10.3390/ph18121885

Figure Lengend Snippet: Effect of IGF1R and INSR knockdown on the Pas2r12-mediated cytosolic delivery of EGFP. Western blot analyses ( A – C ) and confocal laser scanning microscopy images ( D , E ). Graphs B and C show IGF1R and INSR expression levels, respectively, normalized to GAPDH. Cells analyzed with confocal laser scanning microscopy in panel A were analyzed by Western blot ( A – C ). ( D ) Pas2r12-mediated cytosolic delivery of EGFP in knockdown cells, with EGFP fluorescence shown in green, and ( E ) percentage of cells exhibiting cytosolic EGFP delivery. Scale bars represent 20 μm. Statistical comparisons were performed against siNC cells using Student’s t -test. Error bars indicate the standard error of the mean (SEM). * p < 0.05, *** p < 0.001. N = 4.

Article Snippet: Transfection was performed using Lipofectamine 3000 with 5 μg of the IGF1R CRISPR Activation Plasmid (sc-400084-ACT; Santa Cruz Biotechnology).

Techniques: Knockdown, Western Blot, Confocal Laser Scanning Microscopy, Expressing, Fluorescence

Assessment of IGF1R overexpression. ( A ) Verification of IGF1R expression levels in HEKI cells. ( B ) Relative levels of IGF1R expression normalized to GAPDH based on the data in panel A. Values for IGF1R/GAPDH are expressed compared with parental HEK293 cells (set to 1). Statistical comparisons were performed against HEK293 cells using Student’s t -test. Error bars indicate the standard error of the mean (SEM). * p < 0.05, *** p < 0.001. N = 3. ( C ) Subcellular localization of IGF1R is shown in green; nuclei were counterstained with Hoechst 33342 (blue). Scale bars represent 20 μm.

Journal: Pharmaceuticals

Article Title: Role of the Insulin Receptor in Mediating Cytosolic Delivery of Proteins by a Modified Cell-Penetrating Peptide

doi: 10.3390/ph18121885

Figure Lengend Snippet: Assessment of IGF1R overexpression. ( A ) Verification of IGF1R expression levels in HEKI cells. ( B ) Relative levels of IGF1R expression normalized to GAPDH based on the data in panel A. Values for IGF1R/GAPDH are expressed compared with parental HEK293 cells (set to 1). Statistical comparisons were performed against HEK293 cells using Student’s t -test. Error bars indicate the standard error of the mean (SEM). * p < 0.05, *** p < 0.001. N = 3. ( C ) Subcellular localization of IGF1R is shown in green; nuclei were counterstained with Hoechst 33342 (blue). Scale bars represent 20 μm.

Article Snippet: Transfection was performed using Lipofectamine 3000 with 5 μg of the IGF1R CRISPR Activation Plasmid (sc-400084-ACT; Santa Cruz Biotechnology).

Techniques: Over Expression, Expressing

Effects of Pas2r12 or Pas2r12–cargo protein complex stimulation on INSR/IGF1R in IGF1R-overexpressing cells. ( A ) HEKI#66 cells pretreated with DMSO (linsitinib [−]) or linsitinib (linsitinib [+]) were stimulated with Pas2r12, Pas2r12–EGFP, or insulin for 2 min. Level of phosphorylated INSR/IGF1R (pINSR/pIGF1R) was assessed by Western blot. ( B ) Relative levels of pINSR/pIGF1R, normalized to GAPDH, corresponding to the data in panel A. Phosphorylation levels were analyzed using Student’s t -test. Each treatment condition was compared with the solvent-treated HEKI#66 control (linsitinib [−]), and, for each treatment, phosphorylation levels in the linsitinib (−) and linsitinib (+) conditions were also compared. Statistically significant differences compared with the solvent-treated control are indicated on the bar graphs, and significant differences between linsitinib (+) and linsitinib (−) treatments are marked by horizontal lines. Error bars indicate the standard error of the mean (SEM). * p < 0.05, *** p < 0.001. N = 3.

Journal: Pharmaceuticals

Article Title: Role of the Insulin Receptor in Mediating Cytosolic Delivery of Proteins by a Modified Cell-Penetrating Peptide

doi: 10.3390/ph18121885

Figure Lengend Snippet: Effects of Pas2r12 or Pas2r12–cargo protein complex stimulation on INSR/IGF1R in IGF1R-overexpressing cells. ( A ) HEKI#66 cells pretreated with DMSO (linsitinib [−]) or linsitinib (linsitinib [+]) were stimulated with Pas2r12, Pas2r12–EGFP, or insulin for 2 min. Level of phosphorylated INSR/IGF1R (pINSR/pIGF1R) was assessed by Western blot. ( B ) Relative levels of pINSR/pIGF1R, normalized to GAPDH, corresponding to the data in panel A. Phosphorylation levels were analyzed using Student’s t -test. Each treatment condition was compared with the solvent-treated HEKI#66 control (linsitinib [−]), and, for each treatment, phosphorylation levels in the linsitinib (−) and linsitinib (+) conditions were also compared. Statistically significant differences compared with the solvent-treated control are indicated on the bar graphs, and significant differences between linsitinib (+) and linsitinib (−) treatments are marked by horizontal lines. Error bars indicate the standard error of the mean (SEM). * p < 0.05, *** p < 0.001. N = 3.

Article Snippet: Transfection was performed using Lipofectamine 3000 with 5 μg of the IGF1R CRISPR Activation Plasmid (sc-400084-ACT; Santa Cruz Biotechnology).

Techniques: Western Blot, Phospho-proteomics, Solvent, Control

Effect of IGF1R overexpression on the Pas2r12-mediated cytosolic delivery of EGFP. ( A ) Representative confocal images showing the cellular uptake of Pas2r12–EGFP in IGF1R-overexpressing (HEKI) cells. Scale bars represent 20 μm. ( B ) Relative levels of the cytosolic delivery efficiency of EGFP in HEKI cells compared with parental HEK293 cells (set to 100%). Merged images show EGFP fluorescence (green) and differential interference contrast. Statistical comparisons were performed against HEK293 cells using Student’s t -test. Error bars indicate the standard error of the mean (SEM). ** p < 0.01. N = 3.

Journal: Pharmaceuticals

Article Title: Role of the Insulin Receptor in Mediating Cytosolic Delivery of Proteins by a Modified Cell-Penetrating Peptide

doi: 10.3390/ph18121885

Figure Lengend Snippet: Effect of IGF1R overexpression on the Pas2r12-mediated cytosolic delivery of EGFP. ( A ) Representative confocal images showing the cellular uptake of Pas2r12–EGFP in IGF1R-overexpressing (HEKI) cells. Scale bars represent 20 μm. ( B ) Relative levels of the cytosolic delivery efficiency of EGFP in HEKI cells compared with parental HEK293 cells (set to 100%). Merged images show EGFP fluorescence (green) and differential interference contrast. Statistical comparisons were performed against HEK293 cells using Student’s t -test. Error bars indicate the standard error of the mean (SEM). ** p < 0.01. N = 3.

Article Snippet: Transfection was performed using Lipofectamine 3000 with 5 μg of the IGF1R CRISPR Activation Plasmid (sc-400084-ACT; Santa Cruz Biotechnology).

Techniques: Over Expression, Fluorescence

Effects of Pas2r12 or Pas2r12–cargo protein complex stimulation on INSR/IGF1R in INSR-overexpressing cells. ( A ) IN#1 cells pretreated with DMSO (linsitinib [−]) or linsitinib (linsitinib [+]) were stimulated with Pas2r12, Pas2r12–EGFP, or insulin for 2 min. Phosphorylation of INSR/IGF1R (pINSR/pIGF1R) was assessed by Western blot. ( B ) Relative levels of pINSR/pIGF1R were normalized to GAPDH, corresponding to the data in panel A. Phosphorylation levels were analyzed using Student’s t -test. Each treatment condition was compared with the solvent-treated IN#1 control (linsitinib [−]), and for each treatment, phosphorylation levels in the linsitinib (−) and linsitinib (+) conditions were also compared. Statistically significant differences compared with the solvent-treated control are indicated on the bar graphs, and significant differences between linsitinib (+) and linsitinib (−) treatments are marked by horizontal lines. Error bars indicate the standard error of the mean (SEM). * p < 0.05, ** p < 0.01, and *** p < 0.001. N = 3.

Journal: Pharmaceuticals

Article Title: Role of the Insulin Receptor in Mediating Cytosolic Delivery of Proteins by a Modified Cell-Penetrating Peptide

doi: 10.3390/ph18121885

Figure Lengend Snippet: Effects of Pas2r12 or Pas2r12–cargo protein complex stimulation on INSR/IGF1R in INSR-overexpressing cells. ( A ) IN#1 cells pretreated with DMSO (linsitinib [−]) or linsitinib (linsitinib [+]) were stimulated with Pas2r12, Pas2r12–EGFP, or insulin for 2 min. Phosphorylation of INSR/IGF1R (pINSR/pIGF1R) was assessed by Western blot. ( B ) Relative levels of pINSR/pIGF1R were normalized to GAPDH, corresponding to the data in panel A. Phosphorylation levels were analyzed using Student’s t -test. Each treatment condition was compared with the solvent-treated IN#1 control (linsitinib [−]), and for each treatment, phosphorylation levels in the linsitinib (−) and linsitinib (+) conditions were also compared. Statistically significant differences compared with the solvent-treated control are indicated on the bar graphs, and significant differences between linsitinib (+) and linsitinib (−) treatments are marked by horizontal lines. Error bars indicate the standard error of the mean (SEM). * p < 0.05, ** p < 0.01, and *** p < 0.001. N = 3.

Article Snippet: Transfection was performed using Lipofectamine 3000 with 5 μg of the IGF1R CRISPR Activation Plasmid (sc-400084-ACT; Santa Cruz Biotechnology).

Techniques: Phospho-proteomics, Western Blot, Solvent, Control

Loss of PARP10 impairs proliferation of HeLa cells. ( A ) Western blot showing loss of PARP10 expression in HeLa cells with CRISPR/Cas9-mediated PARP10 knockout. ( B ) PARP10-knockout HeLa cells show reduced proliferation rates. The average of three experiments with error bars representing standard deviations is shown. The asterisk indicates statistical significance (using the two-tailed equal variance TTEST). ( C ) Representative clonogenic assay showing reduced proliferation of PARP10-knockout HeLa cells. ( D ) Representative PI flow cytometry profile showing an altered cell-cycle distribution in PARP10-knockout HeLa cells. ( E ) Quantification of cell-cycle distribution in control and PARP10-knockout HeLa cells. The average of four experiments, with error bars as standard deviations, is shown. Statistical significance was calculated using the two-tailed equal variance TTEST. ( F ) Western blot showing the re-expression of PARP10, with a Myc-tag, in PARP10-knockout HeLa cells. ( G ) Exogenous PARP10 expression rescues the proliferation defect of PARP10-deleted HeLa cells. The average of four experiments with error bars representing standard deviations is shown. The asterisk indicates statistical difference between the PARP10 KO and PARP10 KO + Myc-PARP10 samples.

Journal: Nucleic Acids Research

Article Title: PARP10 promotes cellular proliferation and tumorigenesis by alleviating replication stress

doi: 10.1093/nar/gky658

Figure Lengend Snippet: Loss of PARP10 impairs proliferation of HeLa cells. ( A ) Western blot showing loss of PARP10 expression in HeLa cells with CRISPR/Cas9-mediated PARP10 knockout. ( B ) PARP10-knockout HeLa cells show reduced proliferation rates. The average of three experiments with error bars representing standard deviations is shown. The asterisk indicates statistical significance (using the two-tailed equal variance TTEST). ( C ) Representative clonogenic assay showing reduced proliferation of PARP10-knockout HeLa cells. ( D ) Representative PI flow cytometry profile showing an altered cell-cycle distribution in PARP10-knockout HeLa cells. ( E ) Quantification of cell-cycle distribution in control and PARP10-knockout HeLa cells. The average of four experiments, with error bars as standard deviations, is shown. Statistical significance was calculated using the two-tailed equal variance TTEST. ( F ) Western blot showing the re-expression of PARP10, with a Myc-tag, in PARP10-knockout HeLa cells. ( G ) Exogenous PARP10 expression rescues the proliferation defect of PARP10-deleted HeLa cells. The average of four experiments with error bars representing standard deviations is shown. The asterisk indicates statistical difference between the PARP10 KO and PARP10 KO + Myc-PARP10 samples.

Article Snippet: For PARP10 gene knockout, the commercially available PARP10 CRISPR/Cas9 KO plasmid was used (Santa Cruz Biotechnology sc-406703).

Techniques: Western Blot, Expressing, CRISPR, Knock-Out, Two Tailed Test, Clonogenic Assay, Flow Cytometry, Control

Loss of PARP10 results in sensitivity to replication stress. ( A ) Annexin V apoptosis experiment showing increased apoptosis in PARP10-knockout cells following HU treatment. Cells were treated with 1 mM HU for 24 h. Data are shown as normalized to the control (no drug treatment) condition for each cell line. The mean of six experiments with error bars as standard deviations is shown. ( B ) Clonogenic assay showing that PARP10-knockout cells are sensitive to HU, and re-expression of PARP10 corrects this sensitivity. For each cell line, the ratios of HU-treated to non-treated are presented. The mean and standard deviation are shown. ( C ) Quantification of the proportion of cells in G1 at the indicated time points after release from HU (1 mM for 24 h). The mean and standard deviation are shown. Representative flow cytometry histograms are shown in . ( D ) Schematic representation of the DNA fiber combing assay condition, including a representative micrograph. ( E ) DNA fiber combing assay showing reduced replication fork progression in PARP10-knockout cells upon HU exposure. Shown is the quantification of the IdU tract length, with the median values marked. Representative micrographs for each condition are presented in .

Journal: Nucleic Acids Research

Article Title: PARP10 promotes cellular proliferation and tumorigenesis by alleviating replication stress

doi: 10.1093/nar/gky658

Figure Lengend Snippet: Loss of PARP10 results in sensitivity to replication stress. ( A ) Annexin V apoptosis experiment showing increased apoptosis in PARP10-knockout cells following HU treatment. Cells were treated with 1 mM HU for 24 h. Data are shown as normalized to the control (no drug treatment) condition for each cell line. The mean of six experiments with error bars as standard deviations is shown. ( B ) Clonogenic assay showing that PARP10-knockout cells are sensitive to HU, and re-expression of PARP10 corrects this sensitivity. For each cell line, the ratios of HU-treated to non-treated are presented. The mean and standard deviation are shown. ( C ) Quantification of the proportion of cells in G1 at the indicated time points after release from HU (1 mM for 24 h). The mean and standard deviation are shown. Representative flow cytometry histograms are shown in . ( D ) Schematic representation of the DNA fiber combing assay condition, including a representative micrograph. ( E ) DNA fiber combing assay showing reduced replication fork progression in PARP10-knockout cells upon HU exposure. Shown is the quantification of the IdU tract length, with the median values marked. Representative micrographs for each condition are presented in .

Article Snippet: For PARP10 gene knockout, the commercially available PARP10 CRISPR/Cas9 KO plasmid was used (Santa Cruz Biotechnology sc-406703).

Techniques: Knock-Out, Control, Clonogenic Assay, Expressing, Standard Deviation, Flow Cytometry

Overexpression of PARP10 promotes proliferation of non-transformed RPE-1 cells. ( A ) Schematic representation of PARP10 domain organization. The black line underneath shows the length of the PARP10-ΔPARP variant (spanning residues 1–834) which lacks the PCNA-interacting PIP motif and the catalytic PARP domain. RRM: RNA recognition motif; NES: nuclear localization signal; UIM: ubiquitin interacting motifs; PIP: PCNA-interacting motif; PARP: catalytic ADP-ribosyltransferase domain. ( B ) Western blot showing the overexpression of Myc-tagged PARP10 wild-type and ΔPARP in RPE-1 cells. ( C – E ) Overexpression of wild-type, but not PARP-deleted PARP10, promotes proliferation of RPE-1 cells. (C) Representative clonogenic assay. (D) Quantification of cell number from clonogenic assays using CellTiterGlo reagent. The mean and standard deviation are shown. (E) Quantification of EdU-incorporating cells. EdU was added to the media for 45 min prior to harvesting. The mean with standard deviation is shown. Representative flow cytometry plots are shown in . ( F ) DNA fiber combing assay showing increased replication tracts in PARP10-overexpressing RPE-1 cells under normal (no drug treatment) conditions. Shown is the quantification of the IdU tract length, with the median values marked.

Journal: Nucleic Acids Research

Article Title: PARP10 promotes cellular proliferation and tumorigenesis by alleviating replication stress

doi: 10.1093/nar/gky658

Figure Lengend Snippet: Overexpression of PARP10 promotes proliferation of non-transformed RPE-1 cells. ( A ) Schematic representation of PARP10 domain organization. The black line underneath shows the length of the PARP10-ΔPARP variant (spanning residues 1–834) which lacks the PCNA-interacting PIP motif and the catalytic PARP domain. RRM: RNA recognition motif; NES: nuclear localization signal; UIM: ubiquitin interacting motifs; PIP: PCNA-interacting motif; PARP: catalytic ADP-ribosyltransferase domain. ( B ) Western blot showing the overexpression of Myc-tagged PARP10 wild-type and ΔPARP in RPE-1 cells. ( C – E ) Overexpression of wild-type, but not PARP-deleted PARP10, promotes proliferation of RPE-1 cells. (C) Representative clonogenic assay. (D) Quantification of cell number from clonogenic assays using CellTiterGlo reagent. The mean and standard deviation are shown. (E) Quantification of EdU-incorporating cells. EdU was added to the media for 45 min prior to harvesting. The mean with standard deviation is shown. Representative flow cytometry plots are shown in . ( F ) DNA fiber combing assay showing increased replication tracts in PARP10-overexpressing RPE-1 cells under normal (no drug treatment) conditions. Shown is the quantification of the IdU tract length, with the median values marked.

Article Snippet: For PARP10 gene knockout, the commercially available PARP10 CRISPR/Cas9 KO plasmid was used (Santa Cruz Biotechnology sc-406703).

Techniques: Over Expression, Transformation Assay, Variant Assay, Ubiquitin Proteomics, Western Blot, Clonogenic Assay, Standard Deviation, Flow Cytometry

Overexpression of PARP10 in RPE-1 suppresses replication stress and promotes engagement of mutagenic TLS polymerase Polη. ( A ) Clonogenic assay showing that PARP10-overexpressing RPE-1 cells are resistant to HU. For each cell line, the ratios of HU-treated to non-treated are presented. The mean and standard deviation are shown. ( B ) DNA fiber combing assay showing increased replication tracts in PARP10-overexpressing RPE-1 cells under HU treatment. Shown is the quantification of the IdU tract length, with the median values marked. ( C ) Chromatin fractionation experiments showing increased chromatin recruitment of TLS polymerase Polη in PARP10-overexpressing RPE-1 cells following HU treatment (2 mM for 24 h). A repeat experiment, as well as quantification of band intensities are provided in . ( D ) Mutation load in control and PARP10-overexpressing RPE-1 cells calculated from RNA-seq data. Three independent clones each were grown for 30 generations in the presence of doxycycline to induce PARP10 expression. The number of point mutations from loci with at least 10 reads was calculated, and normalized against genome coverage. The mean values are shown ( P = 0.55).

Journal: Nucleic Acids Research

Article Title: PARP10 promotes cellular proliferation and tumorigenesis by alleviating replication stress

doi: 10.1093/nar/gky658

Figure Lengend Snippet: Overexpression of PARP10 in RPE-1 suppresses replication stress and promotes engagement of mutagenic TLS polymerase Polη. ( A ) Clonogenic assay showing that PARP10-overexpressing RPE-1 cells are resistant to HU. For each cell line, the ratios of HU-treated to non-treated are presented. The mean and standard deviation are shown. ( B ) DNA fiber combing assay showing increased replication tracts in PARP10-overexpressing RPE-1 cells under HU treatment. Shown is the quantification of the IdU tract length, with the median values marked. ( C ) Chromatin fractionation experiments showing increased chromatin recruitment of TLS polymerase Polη in PARP10-overexpressing RPE-1 cells following HU treatment (2 mM for 24 h). A repeat experiment, as well as quantification of band intensities are provided in . ( D ) Mutation load in control and PARP10-overexpressing RPE-1 cells calculated from RNA-seq data. Three independent clones each were grown for 30 generations in the presence of doxycycline to induce PARP10 expression. The number of point mutations from loci with at least 10 reads was calculated, and normalized against genome coverage. The mean values are shown ( P = 0.55).

Article Snippet: For PARP10 gene knockout, the commercially available PARP10 CRISPR/Cas9 KO plasmid was used (Santa Cruz Biotechnology sc-406703).

Techniques: Over Expression, Clonogenic Assay, Standard Deviation, Fractionation, Mutagenesis, Control, RNA Sequencing, Clone Assay, Expressing

PARP10 promotes tumor growth in vivo . ( A and B ) PARP10 deletion reduces tumor formation by HeLa cells. (A) Quantification of tumor size, 28 days after subcutaneous injection. A total of eight mice were used for each condition. The mean and standard deviation are shown. (B) Representative images of tumor formation by HeLa control and PARP10-knocokout cells at day 28. ( C ) Exogenous re-expression of Myc-tagged PARP10 restores tumor formation ability. Quantification of tumor size, 28 days after subcutaneous injection is shown. For each condition, five mice were used, which were administered doxycycline in their drinking water to induce exogenous Myc-PARP10 expression. The mean and standard deviation are shown. ( D and E ) PARP10 overexpression promotes tumor formation by non-transformed RPE-1 cells. (D) Quantification of tumor size, 28 days after subcutaneous injection. For each condition, seven mice were used, which were administered doxycycline in their drinking water to induce exogenous Myc-PARP10 expression. The mean and standard deviation are shown. (E) Representative images of tumor formation by RPE-1 cells at day 28. ( F ) Model showing the involvement of PARP10 in carcinogenesis. PARP10 overexpression during transformation confers protection against replication stress by increasing TLS. Targeting PARP10 may reduce proliferation of cancer cells.

Journal: Nucleic Acids Research

Article Title: PARP10 promotes cellular proliferation and tumorigenesis by alleviating replication stress

doi: 10.1093/nar/gky658

Figure Lengend Snippet: PARP10 promotes tumor growth in vivo . ( A and B ) PARP10 deletion reduces tumor formation by HeLa cells. (A) Quantification of tumor size, 28 days after subcutaneous injection. A total of eight mice were used for each condition. The mean and standard deviation are shown. (B) Representative images of tumor formation by HeLa control and PARP10-knocokout cells at day 28. ( C ) Exogenous re-expression of Myc-tagged PARP10 restores tumor formation ability. Quantification of tumor size, 28 days after subcutaneous injection is shown. For each condition, five mice were used, which were administered doxycycline in their drinking water to induce exogenous Myc-PARP10 expression. The mean and standard deviation are shown. ( D and E ) PARP10 overexpression promotes tumor formation by non-transformed RPE-1 cells. (D) Quantification of tumor size, 28 days after subcutaneous injection. For each condition, seven mice were used, which were administered doxycycline in their drinking water to induce exogenous Myc-PARP10 expression. The mean and standard deviation are shown. (E) Representative images of tumor formation by RPE-1 cells at day 28. ( F ) Model showing the involvement of PARP10 in carcinogenesis. PARP10 overexpression during transformation confers protection against replication stress by increasing TLS. Targeting PARP10 may reduce proliferation of cancer cells.

Article Snippet: For PARP10 gene knockout, the commercially available PARP10 CRISPR/Cas9 KO plasmid was used (Santa Cruz Biotechnology sc-406703).

Techniques: In Vivo, Injection, Standard Deviation, Control, Expressing, Over Expression, Transformation Assay

DIO3 reduction attenuates glycolysis and elevates OXPHOS in HGSOC cells (A) HGSOC Control and DIO3-KD cells were analyzed by WB for DIO3 (upper panel). Quantification of normalized bands intensity as fold of control is presented in the right panel. All WB’s are representative of at least three independent repeats. Cell density in control and DIO3-KD cells is presented in the lower panel. (10× objective, scale bar: 100 μm) (B) Intracellular levels of the thyroid hormone T4, measured by LC/MS/MS. Values are mean ± STE, ∗, p < 0.05 (C) Proteomaps of the control and DIO3-KD proteomes using the bionic visualization tool. Metabolism-related pathways (orange, right panel). (D) HGSOC Control and DIO3-KD cells were analyzed by WB for a collection of proteins involved in glycolysis and energy production. β-tubulin was used as loading control. Quantification of normalized bands intensity, as fold of control, is presented in the right panel. WB’s are representative of three independent repeats (E) Levels of Fructose-6-phosphate identified by polar metabolites profiling (F) HGSOC control and DIO3-KD cells were seeded (1000cells/well for 96 h) in triplicates and culture media was collected for lactate measurements. A representative result of three independent repeats is presented (G) HGSOC control and DIO3-KD cells were seeded (4x10 4 cells/well) and after 24 h mitochondrial respiration was assessed. OCR was measured under basal conditions followed by sequential injections of oligomycin (1.5 μM), FCCP (1.5 μM) and rotenone (0.5 μM). Bars represent OCR measurements of basal respiration and ATP production. A representative experiment of three independent repeats is shown (H) Levels of ATP/ADP ratio identified by polar metabolites profiling (I) Total proteins were extracted from OVCAR8 control and MCT8 over-expression (MCT8-OE) cells and evaluated by WB for MCT8, DIO3, HK1, PFKP, GAPDH, PKM2 and ATP5A. β-tubulin was used as a loading control. Protein loading for MCT8 is presented in . Quantification of normalized bands intensity as fold of control is presented in the right panel WB’s are representative of three independent repeats (J) Total proteins were extracted from WT and p53-KO ID8 cells and evaluated by WB for p53, DIO3, HK1 and HK2. β-actin and β-tubulin were used as loading control. Quantification of normalized bands intensity as fold of control is presented in the right panel (K) Intracellular levels of the thyroid hormone T3 following 24 h treatment with the DIO3 inhibitor ITYR-DBRMD (250 μM), measured by ELISA. A representative results of at least four independent repeats is shown. Values are mean ± STE ∗∗, p < 0.005 (L) 50 × 10 3 ES2 cells were seeded in 24-well plates and treated daily with ITYR-DBRMD (250 nM, 500 nM, 1 μM, 2.5 μM, 5 μM, 7.5 μM and 10 μM), or vehicle control (DMSO). After 96 h, total proteins were extracted and analyzed by WB for the glycolytic proteins HK1, PFKP, GAPDH and PKM2. β-actin was used as a loading control. Quantification of normalized bands intensity as fold of control is presented in the right panel. Experiments are representative of three independent repeats. Values are mean ± STE, ∗ p ≤ 0.05; ∗∗ p ≤ 0.01, ∗∗∗ p ≤ 0.0002, ∗∗∗∗ p ≤ 0.0001. (M) 50 × 10 3 OVCAR8 cells were seeded in 24-well plates and treated daily with 1 μM ITYR-DBRMD, or vehicle control (DMSO). After 72 h RNA was extracted and RNA-Seq analysis was performed.

Journal: Molecular Metabolism

Article Title: DIO3 depletion attenuates ovarian cancer growth via reduced glycolysis and alterations in glutamine metabolism

doi: 10.1016/j.molmet.2025.102225

Figure Lengend Snippet: DIO3 reduction attenuates glycolysis and elevates OXPHOS in HGSOC cells (A) HGSOC Control and DIO3-KD cells were analyzed by WB for DIO3 (upper panel). Quantification of normalized bands intensity as fold of control is presented in the right panel. All WB’s are representative of at least three independent repeats. Cell density in control and DIO3-KD cells is presented in the lower panel. (10× objective, scale bar: 100 μm) (B) Intracellular levels of the thyroid hormone T4, measured by LC/MS/MS. Values are mean ± STE, ∗, p < 0.05 (C) Proteomaps of the control and DIO3-KD proteomes using the bionic visualization tool. Metabolism-related pathways (orange, right panel). (D) HGSOC Control and DIO3-KD cells were analyzed by WB for a collection of proteins involved in glycolysis and energy production. β-tubulin was used as loading control. Quantification of normalized bands intensity, as fold of control, is presented in the right panel. WB’s are representative of three independent repeats (E) Levels of Fructose-6-phosphate identified by polar metabolites profiling (F) HGSOC control and DIO3-KD cells were seeded (1000cells/well for 96 h) in triplicates and culture media was collected for lactate measurements. A representative result of three independent repeats is presented (G) HGSOC control and DIO3-KD cells were seeded (4x10 4 cells/well) and after 24 h mitochondrial respiration was assessed. OCR was measured under basal conditions followed by sequential injections of oligomycin (1.5 μM), FCCP (1.5 μM) and rotenone (0.5 μM). Bars represent OCR measurements of basal respiration and ATP production. A representative experiment of three independent repeats is shown (H) Levels of ATP/ADP ratio identified by polar metabolites profiling (I) Total proteins were extracted from OVCAR8 control and MCT8 over-expression (MCT8-OE) cells and evaluated by WB for MCT8, DIO3, HK1, PFKP, GAPDH, PKM2 and ATP5A. β-tubulin was used as a loading control. Protein loading for MCT8 is presented in . Quantification of normalized bands intensity as fold of control is presented in the right panel WB’s are representative of three independent repeats (J) Total proteins were extracted from WT and p53-KO ID8 cells and evaluated by WB for p53, DIO3, HK1 and HK2. β-actin and β-tubulin were used as loading control. Quantification of normalized bands intensity as fold of control is presented in the right panel (K) Intracellular levels of the thyroid hormone T3 following 24 h treatment with the DIO3 inhibitor ITYR-DBRMD (250 μM), measured by ELISA. A representative results of at least four independent repeats is shown. Values are mean ± STE ∗∗, p < 0.005 (L) 50 × 10 3 ES2 cells were seeded in 24-well plates and treated daily with ITYR-DBRMD (250 nM, 500 nM, 1 μM, 2.5 μM, 5 μM, 7.5 μM and 10 μM), or vehicle control (DMSO). After 96 h, total proteins were extracted and analyzed by WB for the glycolytic proteins HK1, PFKP, GAPDH and PKM2. β-actin was used as a loading control. Quantification of normalized bands intensity as fold of control is presented in the right panel. Experiments are representative of three independent repeats. Values are mean ± STE, ∗ p ≤ 0.05; ∗∗ p ≤ 0.01, ∗∗∗ p ≤ 0.0002, ∗∗∗∗ p ≤ 0.0001. (M) 50 × 10 3 OVCAR8 cells were seeded in 24-well plates and treated daily with 1 μM ITYR-DBRMD, or vehicle control (DMSO). After 72 h RNA was extracted and RNA-Seq analysis was performed.

Article Snippet: OVCAR8 cells were seeded (2 × 10 5 /6 well plates) and stably transfected with an MCT8 CRISPR activation plasmid (sc-403824-ACT) or control CRISPR activation plasmid (sc-437275), from Santa Cruz Technologies (Dallas, TX, USA).

Techniques: Control, Liquid Chromatography with Mass Spectroscopy, Over Expression, Enzyme-linked Immunosorbent Assay, RNA Sequencing